Purves Biologie

purves_cover.jpg

Purves Biologie

ISBN: 
978-3-662-58171-1

Das Allrounder-Lehrbuch in der Biologie – aktuell, verständlich, umfassend und interaktiv
Die neue Auflage des Purves, das große Lehrbuch in der Biologie, jetzt umfassend aktualisiert und didaktisch ganz neu aufbereitet. Der Purves deckt die Vorlesungsthemen der gesamten Lebenswissenschaften ab und bietet so den idealen Einstieg und alle Grundlagen für Bachelorstudierende der Biologie, Life Sciences sowie Nebenfächer.

Weiterlesen

Das neue didaktische Konzept Wenden Sie an, was Sie gelernt haben hält nicht nur was es verspricht, sondern es bietet spannende Anreize, sich tiefgehend mit den Themen zu beschäftigen. Lehrende nutzen dieses Werk für originelle Einstiege in ihre Unterrichtsstunden und Vorlesungen, für Schülerinnen und Schüler eignet sich der Purves prima zur Abiturvorbereitung und Studierenden vermittelt er ein zusammenhängendes biologisches Grundwissen. Die Stärken dieses Lehrbuches:- Es werden Zusammenhänge verdeutlicht, nicht nur Fakten vermittelt - Kernaussagen zu Kapitelbeginn liefern die wichtigsten Konzepte und Erkenntnisse in den jeweiligen Themengebieten- Didaktisch hochwertige Grafiken erklären schwierige Sachverhalte auf einen Blick- Interaktive Elemente helfen dabei, das Gelernte besser zu verstehen und anzuwenden- Kurze Zwischenwiederholungen sowie Fragen und Aufgaben am Ende der Kapitel erleichtern die Selbstkontrolle und Prüfungsvorbereitung - „Synapsenfutter“-Abschnitte am Ende der Kapitel zeigen, ob das Gelernte auch tatsächlich verstanden wurde- Eine Einführung in die statistische Datenauswertung im Anhang bereitet Studierende ideal auf Forschungsprojekte vor- von Prof. Dr. Jürgen Markl als erfahrenem Herausgeber und Autor von Lehr- und Schulbüchern bearbeitet und für den deutschen Biologieunterricht optimiert.

Standardwerk für jeden Biologiestudenten! Besonders hervorzuheben: z.T. sehr schöne Abbildungen; außerdem einfach erklärt, so dass es auch einem Abiturienten leicht fällt, die neuen Sachverhalte zu verstehen. Julia Merkel, Uni Mainz

Hervorragend durchdachtes Übersichtswerk. Das Layout ist ansprechend und die didaktische Strukturierung ist absolut überzeugend. Ich empfehle das Buch meinen Studenten als gute Alternative zum Campbell Biologie. Markus Reiser, PH-Weingarten

Datei: 
AnhangGröße
PDF icon purves2019_leseprobe.pdf736.95 KB
Datei: 
AnhangGröße
PDF icon purves2019_inhaltsverzeichnis.pdf106.94 KB
BegriffErklärung
Aasfresser, engl. scavengersauch als Nekrophagen bezeichnet; Tiere, die sich von größeren toten Tieren ernähren, aber normalerweise nicht als Detritivoren eingestuft werden
Abdomen (lat. für „Bauch“), engl. abdomenbei Arthropoden der Hinterleib aus den hinteren Körpersegmenten; bei Säugetieren der auf die Brust folgende Unterleib, der den Darm und die meisten anderen inneren Organe enthält
Aberrationen→ genetische Aberrationen
Abgeleitetes Merkmal, engl. derived traitauch als Apomorphie bezeichnet; Merkmal, das sich im Vergleich zum ursprünglichen (ancestralen) Merkmalszustand bei den Vorfahren verändert hat (vgl. → gemeinsames abgeleitetes Merkmal)
abgestuftes (graduiertes) Membranpotenzial, engl. graded membrane potentialdurch das Öffnen oder Schließen von Ionenkanälen verursachte, geringfügige, lokale Veränderungen des Membranpotenzials
Weitere Begriffe
  • Kapitel 1: Die Erforschung des Lebens (11)
  • Kapitel 2: Leben und Chemie: kleine Moleküle (10)
  • Kapitel 3: Proteine, Kohlenhydrate und Lipide (8)
  • Kapitel 4: Nucleinsäuren und die Entstehung des Lebens (11)
  • Kapitel 5: Zellen: die kleinsten Einheiten des Lebens (13)
  • Kapitel 6: Zelluläre Membranen (14)
  • Kapitel 7: Signalübertragung und Kommunikation zwischen Zellen (14)
  • Kapitel 8: Energie, Enzyme und Stoffwechsel (12)
  • Kapitel 9: Stoffwechselwege zur Gewinnung chemischer Energie (13)
  • Kapitel 10: Photosynthese: Energie aus dem Sonnenlicht (12)
  • Kapitel 11: Zellzyklus und Zellteilung (24)
  • Kapitel 12: Vererbung, Gene und Chromosomen (15)
  • Kapitel 13: DNA und ihre Funktion bei der Vererbung (14)
  • Kapitel 14: Von der DNA zum Protein: die Genexpression (15)
  • Kapitel 15: Genmutationen und molekulare Medizin (13)
  • Kapitel 16: Regulation der Genexpression (18)
  • Kapitel 17: Genome (14)
  • Kapitel 18: Rekombinante DNA und Gentechnik (13)
  • Kapitel 19: Gene, Entwicklung und Evolution (14)
  • Kapitel 20: Prozesse der Evolution (18)
  • Kapitel 21: Die Rekonstruktion der Phylogenie und ihre Anwendungen (3)
  • Kapitel 22: Artbildung (9)
  • Kapitel 23: Evolution von Genen und Genomen (6)
  • Kapitel 24: Die Geschichte des Lebens auf der Erde (3)
  • Kapitel 25: Bakterien, Archaeen und Viren (10)
  • Kapitel 26: Die Entstehung und Diversifizierung der Eukaryoten (12)
  • Kapitel 27: Samenlose Pflanzen: Übergang vom Wasser ans Land (9)
  • Kapitel 28: Die Evolution der Samenpflanzen (12)
  • Kapitel 29: Die Evolution und Vielfalt der Pilze (13)
  • Kapitel 30: Die Entstehung der Tiere und die Evolution ihrer Körperbaupläne (13)
  • Kapitel 31: Protostomier (10)
  • Kapitel 32: Deuterostomier (14)
  • Kapitel 33: Der Pflanzenkörper (12)
  • Kapitel 34: Transport in Pflanzen (11)
  • Kapitel 35: Mineralstoffversorgung der Pflanzen (13)
  • Kapitel 36: Regulation des Pflanzenwachstums (11)
  • Kapitel 37: Fortpflanzung bei Blütenpflanzen (10)
  • Kapitel 38: Reaktionen der Pflanze auf Umweltstress (9)
  • Kapitel 39: Physiologie, Homöostase und Temperaturregulation (17)
  • Kapitel 40: Hormone der Tiere (13)
  • Kapitel 41: Immunologie: Abwehrsysteme der Tiere (19)
  • Kapitel 42: Fortpflanzung der Tiere (17)
  • Kapitel 43: Entwicklung der Tiere (17)
  • Kapitel 44: Nervenzellen, Gliazellen und Nervensysteme (13)
  • Kapitel 45: Sensorische Systeme (16)
  • Kapitel 46: Das Nervensystem von Säugern: Struktur und höhere Funktionen (10)
  • Kapitel 47: Muskeln und Skelette (11)
  • Kapitel 48: Gasaustausch (16)
  • Kapitel 49: Kreislaufsysteme (19)
  • Kapitel 50: Ernährung, Verdauung und Resorption (20)
  • Kapitel 51: Salzhaushalt, Wasserhaushalt und Stickstoffausscheidung (20)
  • Kapitel 52: Verhalten von Tieren (19)
  • Kapitel 53: Abiotische Umwelt und Biogeographie der Organismen (13)
  • Kapitel 54: Populationen (5)
  • Kapitel 55: Wechselbeziehungen zwischen Arten (11)
  • Kapitel 56: Biozönosen (11)
  • Kapitel 57: Ökosysteme (13)
  • Kapitel 58: Die Biosphäre im Wandel (9)
Zurück
Frage 1 von 745
Weiter
  • Welcher Zusammenhang besteht zwischen dem Sauerstoffgehalt der Atmosphäre und der Besiedlung terrestrischer Lebensräume?

    Lösung

    Die Entstehung der Photosynthese führte zu einem allmählichen Anstieg der Sauerstoffkonzentration in der Erdatmosphäre. Bevor die Erde eine sauerstoffreiche Atmosphäre aufwies, war die UV-Einstrahlung auf der Erdoberfläche so intensiv, dass sämtliche an Land lebenden Organismen dadurch getötet wurden. Ein Überleben war nur möglich, wenn die Organismen durch Wasser vor der UV-Strahlung geschützt waren. Als sich O2 in der Atmosphäre anreicherte, begannen die O2-Moleküle miteinander zu reagieren und Ozon (O3) zu bilden. Dadurch baute sich in der oberen Atmosphäre nach und nach eine Ozonschicht auf. Vor etwa 500 Mio. Jahren hatte diese eine solche Dicke erreicht, dass sie ein Leben an Land ermöglichte, weil sie die UV-Strahlung ausreichend abschirmte.
  • Gesetzt den Fall, wir würden auf einem anderen Planeten Leben entdecken. Wie ließe sich feststellen, ob dieses getrennt vom Leben auf der Erde entstanden ist?

    Lösung

    Unter den gemeinsamen Merkmalen aller Organismen der Erde befinden sich einige Eigenschaften, die vermutlich generell für jede Entstehung von Leben zu erwarten sind (wie die Notwendigkeit, aus der Umwelt Energie aufzunehmen, um damit Arbeit zu verrichten), aber auch andere Merkmale, die vermutlich für jede Entstehung von Leben einzigartig sind. So wäre beispielsweise zu erwarten, dass eine andere Entstehung von Leben zwar irgendeine Form eines genetischen Informationssystems nutzt, es gibt aber keinerlei Grund dafür anzunehmen, dass dieses System im Detail auf gleiche Weise funktioniert. Bei einer anderen Entstehung von Leben könnte durchaus auch etwas anderes als DNA oder andere Nucleotide zum Aufbau der DNA Verwendung finden. Selbst wenn bei einer anderen Entstehung von Leben die gleichen Grundbausteine zum Aufbau der DNA genutzt würde, wäre zu erwarten, dass der genetische Code, der festlegt, welche Nucleotidkombinationen welche Aminosäuren in Proteinen codieren, abweicht. Zudem ist es unwahrscheinlich, dass genau die gleiche Reihe von Aminosäuren zum Bau der Proteine dienen würde. Die Gemeinsamkeit dieser Details bei allen Organismen der Erde lassen uns zu dem Schluss kommen, dass das Leben auf der Erde nur auf einen einzigen gemeinsamen Ursprung zurückgeht.
  • Angenommen, eine Fischpopulation würde in einer dunklen Höhle isoliert, in die kein Tageslicht vordringt. Welche auffällige Veränderung wird die Population Ihrer Meinung nach im Laufe der Zeit entwickeln und warum?

    Lösung

    Fische besitzen normalerweise Augen, die dem Sehen dienen und offenbar nur bei Licht funktionieren. Bei einer normalen Fischpopulation würde jede Mutation, die das Sehvermögen beeinträchtigt, stark durch die Selektion ausgemerzt, denn Fische mit beeinträchtigtem Sehvermögen hätten im Vergleich zu solchen mit normal funktionierenden Augen einen Nachteil. Solche Mutationen kommen zwar vor, aber sie werden aus einer Population des Oberflächenwassers durch die natürliche Selektion rasch wieder eliminiert. Bei einer höhlenbewohnenden Population erfolgt hingegen keine Selektion für ein Sehvermögen, daher werden solche Mutationen nicht ausgelesen und sammeln sich in der Population an. Ohne eine Selektion für funktionsfähige Augen ist zu erwarten, dass komplexe Strukturen wie Augen nach und nach verloren gehen. Tatsächlich hat sich bei vielen höhlenbewohnenden Organismen mit der Zeit eine Augenlosigkeit entwickelt. Aber wie kompensieren diese Organismen den Verlust des Sehvermögens? Gewöhnlich erfolgt eine starke Selektion für andere Sinnessysteme, für die kein Licht erforderlich ist, etwa Zellen, die leichte Vibrationen oder chemische Duftstoffe wahrnehmen. Das Ausschlaggebende ist, dass sich in der dunklen Umgebung die Selektionsbedingungen ändern. Weil die natürliche Selektion in der neuen Umgebung andere Merkmale bevorzugt, gehen erwartungsgemäß einige Merkmale verloren und andere kommen neu hinzu.
  • Anhand welcher Informationen erstellen Biologen phylogenetische Bäume?

    Lösung

    Den Verwandtschaftsgrad zwischen verschiedenen Arten ermitteln Biologen durch quantitative Messungen der Ähnlichkeiten und Unterschiede. Je ähnlicher sich zwei Arten sind, desto eher haben sie vor recht kurzer Zeit einen gemeinsamen Vorfahren gehabt, und je unterschiedlicher sie sind, desto wahrscheinlicher lebte ihr gemeinsamer Vorfahre weit zurück in evolutionären Zeiträumen. Erkenntnisse über die phylogenetischen Verwandtschaftsbeziehungen lassen sich auch aus den Fossilbelegen gewinnen und in jüngster Zeit durch Genomanalysen.
  • Welcher Zusammenhang besteht zwischen einer Hypothese und einem Experiment?

    Lösung

    Eine Hypothese ist eine vorgeschlagene Erklärung für eine Beobachtung oder ein Phänomen. Durch ein Experiment wird diese vorgeschlagene Erklärung einer gründlichen Überprüfung unterzogen.
  • Was wird bei einem kontrollierten Experiment kontrolliert?

    Lösung

    Bei einem kontrollierten Experiment wird immer nur eine Variable verändert, während sämtliche anderen Variablen konstantgehalten werden. Dadurch kann man feststellen, welche Auswirkungen diese Variable auf das untersuchte System hat.
  • Durch welche Eigenschaften sind Fragen charakterisiert, die sich eher mittels der vergleichenden Methode als durch ein kontrolliertes Experiment beantworten lassen?

    Lösung

    Wenn Fragen Systeme betreffen, bei denen die Variablen nicht kontrolliert werden können – wie es bei vielen Fragen zu natürlichen Systemen der Fall ist –, kann man mithilfe der vergleichenden Methode Zusammenhänge zwischen der interessierenden Variablen und ihren möglichen Auswirkungen aufzeigen.
  • Warum lassen sich die Ergebnisse biologischer Forschungen an einer Art häufig auf ganz andere Arten übertragen?

    Lösung

    Weil sämtliche Organismen durch die Evolution miteinander verwandt sind, nutzen unterschiedliche Arten ähnliche molekulare, biochemische, zelluläre, physiologische und das Verhalten betreffende Bestandteile, Systeme und Mechanismen. Daher lassen sich an einer bestimmten Art gewonnene Erkenntnisse wahrscheinlich auch auf andere Arten anwenden.
  • Beschreiben Sie ein Beispiel für die Anwendung der modernen Biologie auf die Landwirtschaft.

    Lösung

    Man macht sich die moderne Biologie zunutze, um landwirtschaftlich genutzte Arten – Pflanzen wie Tiere – zu verbessern. Ein Beispiel ist die genetische Verbesserung von Getreidepflanzen, die Nahrungszwecken dienen. Auch bei der Behandlung von Krankheiten bei landwirtschaftlich genutzten Arten macht man sich die Biologie zunutze (indem man z.B. Nutztieren Antibiotika verabreicht) oder um bei Nahrungspflanzen eine Herbizidresistenz zu erreichen.
  • Diskutieren Sie ein Beispiel für ein biologisches Problem, das in direktem Zusammenhang mit dem globalen Klimawandel steht.

    Lösung

    Wie das Beispiel zum Überleben von Korallen bei erhöhten Wassertemperaturen in diesem Kapitel verdeutlicht, stellt die globale Erwärmung für riffbildende Korallen eine enorme Bedrohung dar. Korallenriffe beherbergen ein hohes Maß an Diversität im marinen Ökosystem. Ein weiteres relevantes Beispiel ist die Misere der Eisbären, die für den Fang ihrer Beutetiere – Robben – auf Meereis angewiesen sind. Mit dem Rückgang des Meereises in der Arktis wurden die Jagdgebiete und damit die Möglichkeiten zum Beutefang für die Eisbären immer stärker eingeschränkt.
  • Warum erweisen sich einige Antibiotika als nicht mehr so wirkungsvoll bei der Behandlung bakterieller Erkrankungen wie sie bei ihrer Einführung waren?

    Lösung

    Der Einsatz von Antibiotika schafft eine Situation der künstlichen Selektion analog zur natürlichen Selektion. Jeder Krankheitserreger, der aufgrund seiner genetischen Ausstattung den Antibiotikaeinsatz überlebt, wird diese Eigenschaft an seine Nachkommen weitergeben. Wird das Antibiotikum weiterhin eingesetzt, werden sich die resistenten Erreger vermehren, wodurch sich wiederum die Effizienz des eingesetzten Antibiotikums verringert.
  • Beschreiben Sie, wie sich die Elektronenkonfiguration der Valenzschale auf die Position eines Elements im Periodensystem auswirkt.

    Lösung

    Elemente mit derselben Zahl an Valenzelektronen stehen im Periodensystem in derselben Spalte und bilden eine Gruppe. So besetzen die Elektronen des Natriums folgende Schalen (von innen nach außen): 1s2, 2s2, 2p6, 3s1. Mit einem Elektron auf der Valenzschale wird Natrium der Gruppe 1 zugeordnet. Und auch Lithium und Kalium gehören in diese Gruppe, da sie wie Natrium nur ein Elektron auf der äußeren Schale besitzen.
  • Warum erreicht ein reaktives Atom durch Verbindung mit einem anderen Atom mehr Stabilität?

    Lösung

    Ein Atom ist stabil, wenn es acht Elektronen auf seiner äußeren Schale besitzt (Ausnahmen sind Wasserstoff und Helium, die mit zwei Elektronen auf der äußeren Schale stabil sind). Gehen Atome Bindungen ein, dann teilen sie sich Elektronen mit ihrem Bindungspartner oder sie geben Elektronen an andere Atome ab bzw. nehmen sie von anderen Atomen auf, in dem Bestreben, eine vollständig gefüllte äußere Schale zu erhalten.
  • Erwarten Sie, dass die chemische Zusammensetzung der Erdkruste der des menschlichen Körpers entspricht? Erläutern Sie Ihre Antwort.

    Lösung

    Der menschliche Körper enthält Elemente, die auch in der unbelebten Natur vorkommen, nur mit anderer Häufigkeit.
  • Warum ist eine kovalente Bindung (in wässriger Lösung) stärker als eine Ionenbindung?

    Lösung

    Bei einer kovalenten Bindung ist das gemeinsame Elektronenpaar tatsächlich Bestandteil beider Atome. Die Atome befinden sich in geringer Distanz zueinander. Daher ist viel Energie notwendig, um die Bindung zu spalten. Bei einer Ionenbindung wurden die Elektronen zuvor übertragen und der Abstand der beiden Atome zueinander ist verhältnismäßig groß. Der Energieaufwand, um eine Ionenbindung zu lösen, ist daher niedriger.
  • Geckos sind Eidechsen und wahre Kletterkünstler. Sie vermögen mühelos senkrechte Glasflächen emporzulaufen, wobei ihnen nur ein Zeh ausreicht, um mit ihrem gesamten Körpergewicht an der Fläche zu haften. KellarAutumnund sein Team haben sich mit dem Haftsystem befasst und gezeigt, dass jeder Geckozeh mit Millionen von ca. 100 ?m langen Haaren ausgestattet ist und dass sich jedes Haar noch einmal in Hunderte feine, 200 nm lange und breite Haftläppchen verästelt, die einen engen Kontakt zur Glasoberfläche herstellen. Genaue Messungen haben ergeben, dass 1 Mio. dieser feinen Läppchen ausreichen würden, um ein Tier zu halten, doch besitztein Geckofußmit ca. 1 Mrd.weit mehr von ihnen. Die Zehen haften gut auf hydrophilen wie auch hydrophoben Oberflächen. Man könnte jetzt annehmen, dass der Gecko aufgrund der starken Haftung der zahlreichen Läppchen zeitlebens an eine Stelle des Untergrunds fixiert sein müsste, doch das ist offensichtlich nicht der Fall. Das Tier kann die Bindungen vorteilhafterweise auch lösen, und zwar durch Biegen der Haare. Welche Art von nichtkovalenter Wechselwirkung ist für die erstaunlichen Kletterkünste der Geckos verantwortlich?

    Lösung

    Es handelt sich um ein Bespiel für Van-der-Waals-Kräfte, die über eine kurze Distanz wirken und bei denen Polarität keine Rolle spielt.
  • Ergänzen Sie in der folgenden Reaktionsgleichung die Anzahl der beteiligten Reaktanden und Produkte, sodass die Zahlenbilanz aufgeht: C6H12O6 + O2 → CO2 + H2O

    Lösung

    C6H12O6 + 6 O2 → 6 CO2 + 6 H2O
  • Erläutern Sie an einem Beispiel, wie sich die Energieform während einer chemischen Reaktion ändern kann.

    Lösung

    Bei der Verbrennung von Propan findet eine Energieumwandlung statt. Ein Teil der chemischen Energie wird in Form von Wärmeenergie und Licht frei.
  • Was ist eine Lösung und warum bezeichnen wir Wasser als das „Medium des Lebens“?

    Lösung

    Eine Lösung besteht aus einem Lösungsmittel (z.B. Wasser) und einer gelösten Substanz (z.B. Kochsalz, NaCl). Wasser ist das Medium des Lebens, weil sich viele in lebenden Organismen vorkommende Moleküle in Wasser lösen oder mit ihm interagieren.
  • In einer Zelle befindet sich eine Verbindung mit einer 0,000.000.01-molaren Konzentration. Wie viele Moleküle befinden sich in der Zelle, wenn sie ein Volumen von 0,000.001 l hat?

    Lösung

    Eine einmolare (1 M) Lösung hat eine Konzentration von 1 Mol pro Liter (mol/l). Das heißt, in einem Liter befinden sich 6,02 × 1023 Moleküle. In einer 10-8-molaren Lösung befinden sich in einem Liter 6,02 × 1015 Moleküle. Wenn das Volumen jedoch nur 10-6 l beträgt, dann ist die Zahl der Moleküle darin 6,02 × 109.
  • In menschlichem Gewebe entsteht CO2 als Nebenprodukt der Oxidation von komplexeren Molekülen. Das CO2 gelangt in die Blutbahn und in die roten Blutzellen und wird durch die Reaktion CO2 + H2O → HCO3 + H+ entfernt. Wie wirkt sich diese Reaktion auf den pH-Wert des Blutes aus? Durch welche chemische Reaktion würde der pH-Wert des Blutes wieder hergestellt?

    Lösung

    Die Reaktion erhöht die H+-Konzentration im Blut, senkt also den pH-Wert. Um die H+-Konzentration zu senken und den pH-Wert zu erhöhen, kann die umgekehrte Reaktion als Puffer dienen:
    HCO3- + H+ → CO2 + H2O
  • Wie unterscheiden sich Konstitutionsisomere, Enantiomere und cis-trans-Isomere voneinander?

    Lösung

    Konstitutionsisomere besitzen die gleiche Anzahl von Atomen, doch sind diese in einer unterschiedlichen Reihenfolge miteinander verknüpft. Cis-trans-Isomere enthalten typischerweise eine Doppelbindung zwischen zwei Kohlenstoffatomen und jedes der beiden Kohlenstoffatome ist wiederum kovalent mit zwei unterschiedlichen Gruppen verknüpft (z.B. –H, –CH3 oder eine andere Gruppe). Weisen die beiden Substituenten zur gleichen Seite der Doppelbindung, dann handelt es sich um cis-Isomere, weisen sie in unterschiedliche Richtungen, dann handelt es sich um trans-Isomere. Enantiomere besitzen Kohlenstoffatome, die mit vier verschiedenen Atomen oder Gruppen verknüpft sind, wodurch sich die Isomere wie Bild und Spiegelbild verhalten.
  • Schauen Sie sich die Isomere der Mannose und der Galactose unten an. Warum handelt es sich um Isomere? Welche funktionellen Gruppen enthalten diese Kohlenhydrate und welche Eigenschaften verleihen sie ihnen?

    Lösung

    Mannose und Galactose besitzen dieselbe Summenformel, C6H12O6, doch unterscheiden sie sich in der Anordnung der Atome (vergleichen Sie die C-Atome 2 und 4). Die Zucker tragen Hydroxyl-(OH-)Gruppen als funktionelle Gruppen. Durch ihre Polarität können sich die Monosaccharide in Wasser lösen. Außerdem können die OH-Gruppen durch Kondensationsreaktionen an der Bindung von anderen Molekülen an die Zuckermoleküle beteiligt sein.
  • Unten sind die Grundstrukturen von drei Monomeren eines Biopolymers dargestellt, wobei A, B und C für mehrere Atome stehen. Schreiben Sie die Reaktion auf, die die drei zu dem Polymer ABC verbindet.

    Lösung

    H–A–OH + H–B–OH → H–A–B–OH + H2O
    H–A–B–OH + H–C–OH → H–A–B–C–OH + H2O
  • Der Austausch einer einzelnen Aminosäure eines Moleküls gegen eine andere kann die Raumstruktur des Proteins verändern. Wird beispielsweise die Aminosäure Glycin, die sich an einer bestimmten Position in einem Protein befindet, gegen die Aminosäuren Glutaminsäure oder Arginin ausgetauscht, dann verändert sich der Bereich um die ausgetauschte Aminosäure beträchtlich. Dafür gibt es zwei Erklärungen. Um die normale Struktur zu erhalten, ist an der betreffenden Stelle des Polypeptids:
    a. eine kleine Aminosäure notwendig.
    b. eine ungeladene Aminosäure notwendig.
    Weitere Aminosäuren werden substituiert, um zwischen diesen beiden Möglichkeiten zu unterscheiden. Bei einem Austausch von Glycin gegen Serin oder Alanin bleibt die normale Struktur meist erhalten, der Austausch von Glycin gegen Valin führt dagegen oft zu einer Veränderung. Welche der beiden möglichen Erklärungen wird durch diese Beobachtungen gestützt? Erläutern Sie Ihre Antwort.

    Lösung

    Die Beobachtungen stützen Annahme a. Glycin ist sehr klein und unpolar. Glutaminsäure und Arginin sind erheblich größer und elektrisch geladen. Serin und Alanin sind wiederum kleine Moleküle: Die Raumstruktur des Proteins verändert sich nicht. Serin ist jedoch polar (es trägt eine OH-Gruppe in der Seitenkette) und dennoch beeinflusst es die Struktur nicht. Valin ist groß und unpolar und verändert die Struktur. Es ist in diesem Fall also eine Frage der Molekülgröße, ob der Aminosäureaustausch die Raumstruktur verändert.
  • Menschliches Haar besteht aus bestimmten Proteinen, den Haarkeratinen. Beim Friseur werden zwei Verfahren angewendet, um die dreidimensionale Struktur des Haares zu verändern: Zum Frisieren wird Hitze eingesetzt, bei einer Dauerwelle werden Disulfidbrücken gespalten und wieder neu gebildet. Wie würden Sie diese Phänomene unter dem Aspekt der Proteinstruktur untersuchen?

    Lösung

    Schauen Sie sich „Experiment: Die Primärstruktur bestimmt die Tertiärstruktur“ an. Hitze löst Wasserstoffbrücken, die die Raumstruktur des Haarkeratins aufrechterhalten. Beim Abkühlen bilden sich neue Wasserstoffbrücken. Durch das Frisieren und anschließendes Föhnen wird eine bestimmte Frisur fixiert, die allerdings nur mit Haarfestiger etwas länger hält. Disulfidbrücken sind ebenfalls für die normale Struktur des Haarkeratins notwendig. Bei einer Dauerwelle werden die Disulfidbrücken erst durch ein Reduktionsmittel zerstört. Nach Herstellen der neuen Frisur werden mithilfe eines Oxidationsmittels wieder zahlreiche Disulfidbrücken gebildet. Das hält dann längerfristig. Sie könnten die Struktur des Haarkeratins vor und nach der Zerstörung der Disulfidbrücken untersuchen.
  • Bildet sich eine membranöse Doppelschicht, wenn Phospholipide in ein unpolares Lösungsmittel gegeben werden? Erläutern Sie Ihre Antwort anhand einer Skizze.

    Lösung

    Die Phospholipide würden aggregieren, wobei ihre polaren Köpfe nach innen und ihre Schwänze nach außen weisen würden (umgekehrt zur Orientierung in Membranen). Es würde sich bei den Gebilden eher um Aggregate handeln als um Doppelschichten.
  • Wie unterscheiden sich Fette und Öle?

    Lösung

    Fette sind bei Raumtemperatur fest und die Bindungen zwischen den Kohlenstoffatomen der Fettsäuren sind gesättigt (Einfachbindungen). Öle sind bei Raumtemperatur flüssig und die Bindungen zwischen den Kohlenstoffatomen der Fettsäuren sind ungesättigt (Doppelbindungen).
  • Warum zählt man Steroide und einige Vitamine zu den Lipiden?

    Lösung

    Man zählt Steroide und bestimmte Vitamine zu den Lipiden, weil sie hauptsächlich aus Kohlenstoffatomen bestehen, die mit Wasserstoffatomen verknüpft sind. Außerdem lösen sie sich nicht in Wasser, sondern in unpolaren Lösungsmitteln.
  • Welches sind die wichtigsten Unterschiede zwischen Purinen und Pyrimidinen und wie wirken sie sich auf die Struktur der DNA aus?

    Lösung

    Purine enthalten zwei Ringe aus Stickstoff- und Kohlenstoffatomen, während Pyrimidine aus nur einem Ring bestehen. Die Doppelhelix der DNA hat einen gleichmäßigen Durchmesser, da einem Purin in einem Strang immer ein Pyrimidin im anderen Strang gegenüberliegt.
  • Worauf geht die Diversität der in ihrer Raumstruktur sehr ähnlichen DNA-Moleküle zurück, die für ihre Funktion als Informationsträger eine zentrale Bedeutung hat?

    Lösung

    Während DNA-Moleküle einen ähnlichen Durchmesser und auch eine ähnliche dreidimensionale Struktur besitzen, variieren sie in ihrer Basensequenz, also der Abfolge der Basen im Molekül. Der Informationsgehalt der DNA ist in der variablen Nucleotidsequenz (Basensequenz) verborgen.
  • Einzelsträngige Nucleinsäuren mit einer Länge von etwa 25 Nucleotiden, die spezifisch an Zielmoleküle wie Proteine binden, werden als Aptamere bezeichnet. Sie eignen sich entweder als direkter Wirkstoff an einem Protein oder auch, um kleine Moleküle in Geweben oder Flüssigkeiten zu quantifizieren. Worauf gehen die große Diversität wie auch die Bindungsspezifität der Aptamere zurück?

    Lösung

    Die Zahl der möglichen Moleküle ist bei einer Gesamtzahl von 25 Nucleotiden und vier unterschiedlichen Nucleotiden 425, eine sehr große Zahl. Aufgrund von internen Basenpaarungen des Einzelstrangs (wie bei der RNA) gibt es zahlreiche Möglichkeiten der Faltung, die wiederum eine spezifische Bindung an Zielmoleküle erlauben.
  • Welche Bedingungen, die heute auf der Erde herrschen, könnten die Entstehung des Lebens aus den präbiotischen Molekülen, die von Miller und Ureyin ihren Experimenten eingesetzt wurden, verhindern?

    Lösung

    Die Anwesenheit von freiem O2 in der Atmosphäre führt zu oxidierenden Bedingungen, die die Reduktionen, die in den Miller-Urey-Experimenten beobachtet wurden, verhindern.
  • Notwendige Voraussetzung für die korrekte Interpretation der Ergebnisse von Pasteurs Experiment war das Abtöten von Mikroorganismen durch Hitze. Mittlerweile sind Mikroorganismen bekannt, die sehr hohe Temperaturen überleben können. Verändert dieses Wissen die Interpretation der Ergebnisse? Wie würden Sie die Experimente durchführen, um derartige Mikroorganismen zu inaktivieren?

    Lösung

    Wenn Mikroorganismen Hitze überleben, dann beginnt das Experiment mit bereits vorhandenen Organismen, die sich sowohl im offenen als auch im geschlossenen Gefäß befinden und sich dort vermehren. Um Pasteurs Ergebnisse reproduzieren zu können, dürfen die Gefäße keine solchen Mikroorganismen enthalten. Hitzestabile Mikroorganismen könnten mit Reagenzien wie β-Mercaptoethanol inaktiviert werden, das die Proteine denaturiert.
  • Wie das Miller-Urey-Experiment gezeigt hat, konnten aus anorganischen Gasen, die vermutlich in der Uratmosphäre der Erde vorhanden waren, Aminosäuren entstehen. Diese Aminosäuren waren in Wasser gelöst. Wie würden Sie, auf der Grundlage dessen, was Sie bislang über die Polymerisation von Aminosäuren zu Proteinen erfahren haben, ein Experiment durchführen, um zu zeigen, dass Proteine unter den auf der jungen Erde herrschenden Bedingungen entstehen konnten?

    Lösung

    Ein Vorschlag ist, die Proben nach dem Miller-Urey-Experiment zu trocknen (und so Kondensationsreaktionen bzw. Polymerisationen zu ermöglichen) und sie anschließend zu erhitzen. Diese Bedingungen könnten auf der jungen Erde in Vulkangestein geherrscht haben.
  • Warum war es für die Entstehung von Leben so bedeutend, dass sowohl Informationen codiert als auch Reaktionen katalysiert werden konnten?

    Lösung

    Ein Merkmal lebender Systeme ist die Fähigkeit zur Reproduktion und diese geht von bereits existierenden Organismen aus. Die Anweisungen für die Bildung eines identischen Organismus müssen an die Nachkommen weitergegeben werden. Dies wiederum setzt informationstragende Moleküle voraus. In lebenden Systemen finden permanent chemische Umwandlungen statt, doch die normalen chemischen Prozesse sind zu langsam, als dass sie für den Organismus nutzbar wären. Daher sind Katalysatoren notwendig, die die Reaktionen beschleunigen.
  • Warum war die Entdeckung von Ribozymen für die Formulierung der Hypothese von der RNA-Welt so wichtig?

    Lösung

    Eine besondere Herausforderung hinsichtlich der Formulierung einer Hypothese zur Entstehung des Lebens war die Notwendigkeit eines Moleküls, das sich als Informationsträger eignet, und eines Moleküls, das katalytische Aktivität besitzt. Ohne eines der beiden kann Leben, wie wir es kennen, nicht existieren. Die Entdeckung, dass das informationstragende RNA-Molekül auch als Katalysator dienen kann, hat dieses Problem gelöst. Ribozyme, auch als katalytische RNA bekannt, sind RNA-Moleküle, die biochemische Reaktionen mit hoher Spezifität beschleunigen können.
  • In Organismen ist der Katalysator für die Bildung der Peptidbindung ein RNA-Molekül, das nicht als Informationsträger dient. Inwiefern passt diese Erkenntnis zur Hypothese der RNA-Welt?

    Lösung

    In lebenden Systemen sind es meist Proteine, die katalytische Aktivität besitzen, also Enzyme. Die Polymerisation von Aminosäuren zu Proteinen mit katalytischer Aktivität muss allerdings stattgefunden haben, bevor die Proteinkatalysatoren selbst entstanden sind. Durch eine RNA, die ursprünglich möglicherweise ebenfalls genetische Information enthalten hat und die als Katalysator an der Proteinsynthese beteiligt ist, ist das Henne-Ei-Problem gelöst.
  • Warum sind Zellmembranen für die Evolution lebender Organismen von so großer Bedeutung?

    Lösung

    Die Zellmembran schafft einen Reaktionsraum, in dem chemische Verbindungen, die für die Reaktionen des Lebens notwendig sind, aufkonzentriert werden können. Die Membran gewährleistet so ein geeignetes Milieu in der Zelle, das sich von dem der äußeren Umgebung unterscheidet.
  • Wie würden Sie vorgehen, wenn Sie einen Hinweis auf Zellen suchen, die vor mehr als 3 Mrd. Jahren existiert haben?

    Lösung

    Als erstes suchen Sie Gesteinsformationen, die mehr als 3 Mrd. Jahre alt sind. Von dortigen Gesteinsproben untersuchen Sie dann Dünnschnitte unter dem Mikroskop auf die Anwesenheit von Strukturen, die wie Zellen oder Zellketten aussehen. Und als Letztes führen Sie eine chemische Analyse des Gesteins durch, die Aufschluss über chemische Signaturen des Lebens geben soll, wie spezifische Kohlenstoffisotopverhältnisse, die auf eine einstige Photosyntheseaktivität zurückgehen.
  • Inwiefern erfüllt eine lebende Zelle alle Kriterien des Lebens?

    Lösung

    Leben bedeutet biologische Kontinuität: Die Zelltheorie führt diese zurück auf die Kontinuität der Zelle. Leben ist verbunden mit chemisch komplexen Vorgängen: Die Zelltheorie besagt, dass diese komplexen chemischen Prozesse innerhalb von Zellen stattfinden. Leben unterliegt einer Entwicklung und Evolution: Die Zelltheorie verknüpft diese Dynamik mit Zellen, da in ihnen genetische Veränderungen stattfinden, die an die nächste Zellgeneration weitergegeben werden.
  • Welche Funktion haben Plasmamembranen und die Membranen der Organellen?

    Lösung

    Die Membranen, die Zellen und Organellen umgeben, schaffen Reaktionsräume, sogenannte Kompartimente. Die Plasmamembran trennt den Zellinhalt und damit die für die Aufrechterhaltung des Lebens wichtigen Reaktionen von der äußeren Umgebung ab. Genauer: Die Plasmamembran erlaubt die Aufrechterhaltung eines zellulären Milieus, das sich in den Komponenten und ihren Konzentrationen von der Beschaffenheit der äußeren Umgebung unterscheidet. Membranen von Organellen schaffen spezielle Reaktionsräume und erlauben damit spezifische Funktionen. Sie trennen schädliche Verbindungen vom Rest der Zelle ab, dem Cytoplasma.
  • Beschreiben Sie Aufbau undFunktion einer für eine prokaryotische Zelle typischen Struktur wie Zellwand, Kapsel, Geißel oder Pilus.

    Lösung

    Die Zellwand besteht aus einem großen Komplex aus Polysacchariden und Peptiden. Sie stabilisiert die Zelle und verleiht ihr ihre Form. Die Kapsel ist eine schleimige Polysaccharidschicht, die die Zellwand mancher Prokaryoten umgibt und die Zellen vor dem Austrocknen bewahrt. Sie kann auch der Anheftung an andere Zellen dienen. Die Geißel besteht aus Strängen eines großen Proteins, das als Flagellin bezeichnet wird und das über einen Motorkomplex in der Zellwand und der Plasmamembran verankert ist. Die Geißel dient der Fortbewegung.
  • Woraus bestehen das Nucleoid und das Cytoplasma einer prokaryotischen Zelle?

    Lösung

    Das Nucleoid besteht aus DNA und Proteinen. Das Cytoplasma enthält, gelöst in Wasser, die zahlreichen anderen kleinen und großen Moleküle des Lebens.
  • Welches sind die wichtigsten Unterschiede zwischen prokaryotischen und eukaryotischen Zellen?

    Lösung

    Prokaryotische Zellen sind kleiner als eukaryotische Zellen, und ihnen fehlen Organellen.
  • Wie viele Membranen muss ein Molekül auf dem Weg passieren? a) Wie viele sind es vom Inneren eines Chloroplasten (Stroma) in das Innere eines Mitochondriums (Matrix)? b) Wie viele sind es auf dem Weg vom Inneren eines Lysosoms zur Außenseite der Zelle? c) Wie viele sind es von einem Ribosom zu einem anderen?

    Lösung

    a. vier Membranen: zwei des Chloroplasten und zwei des Mitochondriums
    b. zwei Membranen: eine Membran des Lysosoms und die Plasmamembran (über die Fusion von Vesikeln mit der Plasmamembran; die Moleküle passieren die Membranen nicht selbst)
    c. keine Membran: Ribosomen besitzen keine Membranen; sind Ribosomen allerdings mit dem endoplasmatischen Reticulum (ER) assoziiert, dann müsste die Antwort „zwei Membranen“ lauten: eine auf dem Weg in das ER und eine auf dem Weg aus dem ER hinaus
  • Der Wirkstoff Vincristin wird zur Therapie vieler Krebsformen eingesetzt. Seine Wirkung beruht offenbar darauf, dass er die Mikrotubulian der Depolymerisation hindert. Vincristin hat zahlreiche Nebenwirkungen wie den Verlust sich teilender Zellen und neuronale Probleme. Erläutern Sie, warum.

    Lösung

    Mikrotubuli kleiden lange Axone von Nervenzellen aus, wo sie als eine Art Schienensystem für Vesikel fungieren, die Substanzen entlang eines Axons transportieren. Ohne Mikrotubuli kann der Vesikelinhalt nicht zu seinem Bestimmungsort gelangen, was zu neuronalen Problemen führen kann. Die Depolymerisation von Mikrotubuli kann die Zellteilung beeinflussen, da Mikrotubuli Hauptbestandteile des bei der Kernteilung aktiven Spindelapparats sind.
  • Der Weg neu synthetisierter Proteine durch die Zelle lässt sich mithilfe von Pulse-Chase-Experimenten nachvollziehen. Dazu werden die Proteine während der Synthese mit einem radioaktiven Isotop (Pulse) markiert. Anschließend werden die Proteine im Verlauf ihrer Prozessierung in der Zelleverfolgt (Chase). Die radioaktiv markierten Proteine werden in der Zelle lokalisiert, indem man Zellorganellen isoliert und ihre Radioaktivität quantifiziert. Wie würden Sie diese Methode einsetzen und welche Ergebnisse würden Sie erwarten, wenn Sie Folgendes untersuchten: a) ein lysosomales Enzym und b) ein Protein, das aus der Zelle exportiert wird?

    Lösung

    a. Der Weg eines lysosomalen Enzyms wäre: Ribosom → Lumen des ER → Golgi-Apparat → Golgi-Vesikel → Lysosom
    b. Der Weg eines Exportproteins einer Tierzelle wäre: Ribosom → Lumen des ER → Golgi-Apparat → Golgi-Vesikel → Plasmamembran → Extrazellularraum
  • Breitet sich ein Tumor im Körper aus, müssen sich Tumorzellen aus der sie umgebenden extrazellulären Matrix lösen und die Matrix muss im Verlauf der Zellmigration verdaut werden. Wie könnten diese Ereignisse ablaufen?

    Lösung

    Anfangs werden Moleküle abgebaut, die die Plasmamembran mit der extrazellulären Matrix verbinden. Anschließend bildet und sezerniert die Zelle Enzyme, die die Makromoleküle der extrazellulären Matrix spalten. Die Zelle bewegt sich mithilfe von Actinfilamenten fort.
  • Inwiefern unterstützt die Struktur einer Zellwand ihre Funktion?

    Lösung

    Eine Zellwand enthält Cellulosefasern, die der Pflanze zwar durch ihre Festigkeit Halt geben, die aber auch flexibel genug sind, dass sich die Pflanze biegen kann. Die Zellwand stellt eine zusätzliche Barriere dar, die die Zelle vor Infektionen schützt, doch besitzen die Zellwände Poren (Plasmodesmen), die den Durchtritt von Stoffen in das Cytoplasma benachbarter Zellen ermöglichen.
  • Wie könnten Sie mithilfe einer chemischen Analyse eine pflanzliche und eine tierische Zellwand unterscheiden?

    Lösung

    In der chemischen Analyse der Pflanzenzelle würde Cellulose in der extrazellulären Matrix nachgewiesen, die Analyse der Tierzelle ergäbe die Anwesenheit von Kollagen in der extrazellulären Matrix. Durch diese beiden Verbindungen können die Zelltypen eindeutig zugeordnet werden.
  • Wie könnte die Einstülpung der Plasmamembran in einer prokaryotischen Zelle zum Endomembransystem geführt haben?

    Lösung

    Die Plasmamembran könnte sich eingestülpt und anschließend abgeschnürt haben, wodurch sich die Vesikel des Golgi-Apparats und die abgeflachten Taschen des ER hätten bilden können.
  • Werden sie aus einer Zelle entfernt, sind Organellen wie Mitochondrien nicht länger funktionstüchtig. Welcher Aspekt der Endosymbiontentheorie wird durch diese Beobachtung untermauert?

    Lösung

    Die Endosymbiontentheorie geht davon aus, dass eine Zelle eine andere dauerhaft aufgenommen hat. Mit der Zeit hat die aufgenommene Zelle einen Teil ihrer DNA und ihrer Funktionen verloren und damit auch die Fähigkeit, autonom in der Wirtszelle existieren zu können. Die aufgenommene Zelle war nun zu einem Organell der Wirtszelle geworden.
  • Auf welche Weise sind die hydrophoben und hydrophilen Abschnitte der Phospholipide an der Ausbildung der Phospholipiddoppelschicht beteiligt?

    Lösung

    Die hydrophilen „Köpfe“ der Fettsäuren sind die polaren Enden der Moleküle, die hydrophoben „Schwänze“ sind die unpolaren Enden. Die Köpfe neigen demnach dazu, sich mit Wassermolekülen zusammenzulagern, während sich die Schwänze vom Wasser weg orientieren. In einer wässrigen Umgebung ordnen sich die Fettsäuremoleküle so an, dass ihre Schwänze miteinander in Wechselwirkung treten und ihre Köpfe nach außen zu den Wassermolekülen gerichtet sind, sodass sich eine Doppelschicht ausbildet.
  • Wie unterscheidet sich ein integrales Membranprotein von einem peripheren?

    Lösung

    Ein integrales Membranprotein ist durch hydrophobe Wechselwirkungen zumindest teilweise in die Lipiddoppelschicht eingebettet. Es muss auf seiner Oberfläche genügend Aminosäuren mit hydrophoben Seitenketten exponieren, die mit den Fettsäureketten im Inneren der Doppelschicht in Wechselwirkung treten können. Einem peripheren Membranprotein fehlen größere hydrophobe Regionen auf der Oberfläche. Daher interagiert es nicht mit dem hydrophoben Innenbereich der Membran. Stattdessen ist es über Wechselwirkungen mit integralen Membranproteinen oder mit den polaren Kopfgruppen der Lipide an der Membran verankert.
  • Welche Erkenntnisse über Membranen liefern die Gefrierbruchtechnik und Zellfusionsexperimente?

    Lösung

    Die Ergebnisse von Gefrierbruch- und Zellfusionsexperimenten weisen darauf hin, dass unpolare Membranproteine mit dem hydrophoben Innenbereich der Lipiddoppelschicht assoziiert sind. Zellfusionsexperimente zeigen außerdem, dass sich Proteine lateral innerhalb der Membranebene bewegen können.
  • Wandelt sich eine normale Lungenzelle in eine Tumorzelle um, finden in der Plasmamembran viele Veränderungen statt. Wie würden Sie das Phänomen untersuchen, dass die Plasmamembran einer Tumorzelle eine höhere Fluidität und eine schnellere Diffusion von Lipiden und Proteinen in der Membranebene aufweist als eine normale Zelle?

    Lösung

    Um die Membranfluidität zu ermitteln, markieren Sie eine geringe Menge eines Lipids oder Proteins mit einem Farbstoff und warten ab, bis die Moleküle in die Membran einer Tumorzelle sowie einer normalen Zelle integriert wurden (zu erkennen an einem farbigen Punkt auf der Zelloberfläche). Dieser Punkt wird sich durch Diffusion der Lipid- oder Proteinmoleküle in der Membranebene über die Zelloberfläche bewegen und lässt sich unter dem Mikroskop verfolgen. Bei Tumorzellen könnte die Diffusion rascher vonstattengehen als bei gesunden Zellen.
  • Beschreiben Sie ein Experiment, mit dem sich die Funktion von Kohlenhydraten bei der Zell-Zell-Erkennung und Zell-Zell-Adhäsion untersuchen lässt.

    Lösung

    Enzyme, die man als Glykosidasen bezeichnet, spalten die Bindung zwischen Zuckermolekülen. Damit kann man auch Glykoproteine fast vollständig deglykosylieren (mit Ausnahme des ersten, direkt mit einer Aminosäure verknüpften Monosaccharids). Nehmen Sie ein Gewebe aus miteinander assoziierten Zellen (z.B. von einem Schwamm), und trennen Sie die Zellen voneinander. Anschließend behandeln Sie die Zellen mit geeigneten Glykosidasen, um die Kohlenhydrate weitgehend zu entfernen. Diese Behandlung sollte die Zell-Zell-Erkennung und Zell-Zell-Adhäsion verhindern.
  • Welche Eigenschaften einer Substanz legen fest, wie schnell sie durch eine Membran diffundiert?

    Lösung

    Die Eigenschaften, die die Diffusionsgeschwindigkeit durch eine Membran beeinflussen, sind die Art des Moleküls, dessen Größe bzw. Masse (ein kleineres Molekül diffundiert rascher als ein größeres), die elektrische Ladung (je unpolarer, umso schneller) und der Konzentrationsgradient (je steiler der Gradient, umso höher die Diffusionsrate).
  • Welche Auswirkung hat es auf die roten Blutzellen, wenn die Nieren zu viele Ionen aus dem Blut entfernen und das Blutplasma gegenüber dem Cytoplasma der roten Blutzellen hypotonisch wird?

    Lösung

    Ist das Blut hypotonisch, dann strömt Wasser in die Erythrocyten, wodurch diese anschwellen und möglicherweise platzen. (Folge kann eine Form der Blutarmut sein, die als hämolytische Anämie bezeichnet wird.)
  • Zellen des Nervensystems können eine im Vergleich zur äußeren Umgebung höhere Konzentration an K+-Ionen enthalten. Welche Rolle spielt die Plasmamembran bei der Aufrechterhaltung dieses Ungleichgewichts? Wie können K+-Kanäle in der Membran zur Beseitigung dieses Ungleichgewichts beitragen?

    Lösung

    Die Plasmamembran ist durch die hydrophoben Lipide verhältnismäßig undurchlässig für geladene Ionen wie K+. Ein bestimmter Kanaltyp erlaubt die Diffusion von K+-Ionen auf die Zellaußenseite, bis die K+-Konzentration auf beiden Seiten der Membran gleich ist und ein Gleichgewicht herrscht.
  • Warum ist für den aktiven Transport die Zufuhr von Energie notwendig?

    Lösung

    Substanzen diffundieren im Raum, bis sich die Gesamtverteilung nicht mehr verändert, also ein Gleichgewicht erreicht ist. Diesem natürlichen Bestreben entgegenzuwirken erfordert Stoffwechselenergie.
  • Weshalb gehört die Na+/K+-Pumpe zu den Antiportern?

    Lösung

    Ein Antiporter befördert zwei gelöste Substanzen in entgegengesetzte Richtungen durch die Membran. Die Natrium/Kalium-Pumpe transportiert Na+-Ionen durch die Plasmamembran aus der Zelle hinaus und zugleich K+-Ionen in die Zellen hinein.
  • Welches sind die Unterschiede zwischen dem primär und dem sekundär aktivenTransport?

    Lösung

    Beim primär aktiven Transport wird die Energie, die für den Transport gegen den Konzentrationsgradienten erforderlich ist, direkt durch die Hydrolyse von ATP bereitgestellt. Beim sekundär aktiven Transport stammt die Energie von einem Gradienten, der vorher durch einen (primär) aktiven Transport aufgebaut wurde.
  • Welches sind die Gemeinsamkeiten und welches die Unterschiede zwischen dem aktiven Transport und der erleichterten Diffusion?

    Lösung

    Sowohl beim aktiven Transport wie auch bei der erleichterten Diffusion wird der Transport durch die Membran durch Proteine beschleunigt, die die zu transportierende Substanz binden. Der aktive Transport erfordert jedoch Energie, um die Substanz gegen ihren Konzentrationsgradienten und damit gegen die Diffusionsrichtung zu befördern. Die erleichterte Diffusion benötigt dagegen keine chemische Energie, da die Substanz ihrem Konzentrationsgefälle folgend diffundiert bzw. transportiert wird.
  • Wie unterscheiden sich Phagocytose und Pinocytose?

    Lösung

    Bei der Phagocytose wird ein großes Vesikel gebildet, dessen Membran von der Plasmamembran abstammt und das Makromoleküle umschließt. Bei der Pinocytose werden kleinere Vesikel gebildet, die Wasser und darin gelöste Substanzen enthalten.
  • Beschreiben Sie die rezeptorvermittelte Endocytose und nennen Sie ein Beispiel für einen Prozess, an dem die rezeptorvermittelte Endocytose beteiligt ist.

    Lösung

    Bei der rezeptorvermittelten Endocytose bindet ein Molekül an ein Rezeptormolekül in der Plasmamembran. Die Plasmamembran faltet sich um die betroffenen Rezeptoren ein. Das Vesikel schnürt sich von der Plasmamembran nach innen ab, wandert mitsamt seinem Inhalt tiefer in das Zellinnere und fusioniert dort gewöhnlich mit einem primären Lysosom. Ein Beispiel ist die Endocytose von Lipoproteinpartikeln aus dem Blut in die Leberzellen.
  • Unter welche Bedingungen ist die autokrine Signalübertragungfür die Zelle besonders vorteilhaft?

    Lösung

    Durch die autokrine Signalübertragung hält die Zelle eine spezielle Funktion aufrecht. Eine Zelle könnte beispielsweise ein Signal erhalten, sich zu differenzieren und ein vielzelliges Gewebe zu bilden. Die erste Zelle würde sich nach Ausschüttung eines von ihr selbst produzierten Signals selbst zum Wachstum anregen und sich teilen.
  • Wie können Hormone zelluläre Rezeptoren erreichen?

    Lösung

    Hormone können bei Tieren mit dem Blutkreislauf zu den Rezeptoren der Zielzellen gelangen. Bei Pflanzen werden Hormone z.B. über das aus Leitbündeln bestehende Gefäßsystem verteilt.
  • Alle Zellen besitzen grundsätzlich das genetische Potenzial, auf alle innerhalb eines Organismus zirkulierenden Signale zu reagieren. Wodurch wird die Reaktion spezifisch?

    Lösung

    Die Reaktion auf ein Signal wird dadurch spezifisch, dass nur bestimmte Zellen den Rezeptor für ein bestimmtes Signal synthetisieren (exprimieren).
  • Was ist die Dissoziationskonstante Kd und was sagt sie über die Wahrscheinlichkeit aus, mit der ein Signalmolekül eine zelluläre Reaktion hervorruft?

    Lösung

    Die Dissoziationskonstante ist das Verhältnis der Geschwindigkeit, mit der der Rezeptor und der daran gebundene Ligand dissoziieren, und der Geschwindigkeit, mit der sie aneinander binden. Je höher Kd, umso weniger wahrscheinlich ist es, dass das Signalmolekül an seinen Rezeptor bindet und die Zelle bei einer bestimmten Konzentration von Ligand und Rezeptor auf das Signal reagiert.
  • Worauf beruht die Spezifität der Bindung zwischen einem Rezeptor und seinemLiganden und warum ist sie so wichtig?

    Lösung

    Die Bindung zwischen einem Rezeptor und seinem Liganden ist abhängig von der Raumstruktur der beiden Moleküle und von hydrophoben und hydrophilen Wechselwirkungen. Sie sind die Grundlage für die Spezifität der Bindung. Diese ist wichtig, um sicherzustellen, dass auf jedes Signal die passende biologische Antwort erfolgt.
  • Wie unterscheiden sich membranständige und intrazelluläre Rezeptoren?

    Lösung

    Intrazellulären Rezeptoren fehlen große unpolare Oberflächen, die eine Insertion in die Plasmamembran erlauben würden. Ihre nach außen gerichteten Bereiche sind polar, sodass sie mit dem wässrigen Milieu des Cytoplasmas in Wechselwirkung treten können. Während membranständige Rezeptoren in der Membran verankert bleiben, können intrazelluläre Rezeptoren nach Bindung ihres Liganden in den Zellkern wandern.
  • Wie kann ein aktiviertes G-Protein wie Ras eine Reaktion auf die Bindung eines Liganden verstärken?

    Lösung

    Eine Verstärkung erfolgt, da jedes aktivierte Ras-Molekül eine Phosphorylierung katalysiert und daher viele Raf-Moleküle aktiviert, von denen jedes wiederum zahlreiche MEK-Moleküle aktiviert usw. Das allgemeine Prinzip lautet: ein Enzymmolekül → viele Substratmoleküle.
  • Zyklisches AMP dient bei vielen verschiedenen Reaktionen als sekundärer Botenstoff. Wie kann dasselbe Molekül in verschiedenen Zelltypen auf unterschiedliche Weise wirken?

    Lösung

    Die verschiedenen Zellen enthalten unterschiedliche Zielmoleküle, an die cAMP binden kann, und diese Zielmoleküle können wiederum unterschiedliche Aktivitäten und Funktionen besitzen. Die Bindung von cAMP verändert die Gestalt des Zielmoleküls (z.B. die Tertiärstruktur eines Proteins).
  • Wie werden Signaltransduktionskaskaden reguliert?

    Lösung

    Die Regulation von Signaltransduktionskaskaden erfolgt auf drei Wegen: durch Modulierung der Konzentrationen von sekundären Botenstoffen (z.B. ist Gas NO sehr instabil), durch Unterschiede in den Konzentrationen einzelner Komponenten des Signalwegs und durch Enzyme, die die Zielmoleküle verändern (z.B. Phosphatasen, die Phosphatgruppen von Proteinen der Kaskade entfernen).
  • Inwiefern umfasst der Oxytocinsignalweg mehrere Signaltransduktionswege?

    Lösung

    Oxytocin vermittelt seine Wirkung über G-Proteine wie auch über Ionenkanäle. Es bindet an einen G-Protein-gekoppelten Rezeptor, wodurch der IP3-DAG-Signalweg aktiviert wird, der wiederum über die Öffnung von Ionenkanälen zu einer Freisetzung von Ca2+-Ionen in das Cytoplasma führt. Im Gehirn stimulieren die Ca2+-Ionen indirekt die Aktivität von Nervenzellen, da sie in der Plasmamembran befindliche Na+-Kanäle öffnen.
  • Welche Formen der zellulären Reaktion auf ein Signal erfolgen rascher, welche langsamer? Erläutern Sie Ihre Antwort.

    Lösung

    Die Öffnung von Ionenkanälen zählt zu den kurzfristigen Reaktionen und auch Enzymmodifikationen erfolgen verhältnismäßig schnell. Veränderungen der Genexpression umfassen dagegen zahlreiche Schritte, sodass die Signalübertragung über Transkriptionsfaktoren langsamer ist.
  • Listen Sie die charakteristischen Merkmale der direkten Kommunikation über Zell-Zell-Verbindungen und der rezeptorvermittelten Signalübertragung zwischen Zellen auf. Welches sind die Vorteile der direkten Kommunikation gegenüber der chemischen Signalübertragung?

    Lösung

    Merkmale der direkten Kommunikation über Zell-Zell-Verbindungen: Die Größe der Signalmoleküle ist durch den Durchmesser der Verbindungskanäle begrenzt. Sie ist unspezifisch, aber schnell. Das Cytoplasma der beteiligten Zellen ist direkt miteinander verbunden.
    Merkmale der rezeptorvermittelten Signalübertragung zwischen Zellen: Die Signalmoleküle können größer sein. Sie ist spezifisch, aber langsamer. Es gibt keine direkte Verbindung zwischen dem Cytoplasma der beteiligten Zellen.
  • Inwiefern lassen sich die Volvocales heranziehen, um die möglichen Schritte der Entwicklung einer interzellulären Kommunikation und der Gewebebildung nachzuvollziehen?

    Lösung

    Neben dem reinen Einzeller Chlamydomonas haben sich Formen entwickelt, die aus unterschiedlich großen Kolonien untereinander kommunizierender Zellen bestehen (Gonium, Pandorina, Eudorina). Einige Formen mit noch größeren Kolonien weisen eine Differenzierung in somatische und reproduktive Zellen auf (Pleodorina, Volvox).
  • Der Süßwasserpolyp Hydra, ein kleines Nesseltier, besitzt eine apikale Region (Kopfregion) mit Mund und Tentakeln, einen schlanken Körper und eine basale Fußscheibe. Hydra kann sich ungeschlechtlich vermehren, indem sich die Zellen der Körperwand differenzieren und eine Knospe bilden, die dann zu einem neuen Organismus auswächst. Die Knospen entstehen nur in bestimmten Abständen von der apikalen Region. Das hat zu der Hypothese geführt, dass die Kopfregion ein Molekül freisetzt, das im Körper nach unten diffundiert und in hohen Konzentrationen (d.h. in der Nähe des Kopfes) die Knospenbildung hemmt. Hydra besitzt kein Kreislaufsystem, sodass der Inhibitor von Zelle zu Zelle diffundieren muss. Wenn Ihnen ein Antikörper zur Verfügung stünde, der an Connexin bindet und so die Gap Junctions blockiert, wie würden Sie zeigen, dass der inhibierende Faktor von Hydra durch diese Zell-Zell-Verbindungen wandert?

    Lösung

    Man könnte Experimente durchführen, in denen man in die Kopfregion von Hydra eine Lösung des Antikörpers appliziert. Der Antikörper wird die Diffusion des Signalmoleküls aus dem oberen in den unteren Teil des Körpers verhindern und – wenn die Hypothese zutrifft – eine Knospenbildung im oberen Teil des Körpers erlauben. Außerdem würde man ein Kontrollexperiment durchführen, bei dem eine Lösung ohne Antikörper appliziert wird. Bei dieser Kontrolle bliebe die Knospenbildung im oberen Abschnitt des Körpers aus.
  • Wie unterscheiden sich endergonische und exergonische Reaktionen und welche Bedeutung hat ein positiver oder negativer ΔG-Wert?

    Lösung

    Exergonische Reaktionen liefern freie Enthalpie, da die freie Enthalpie der Reaktanden größer ist als die der Produkte. Das Umgekehrte gilt für endergonische Reaktionen, indem sie freie Enthalpie erfordern. Ein positiver ΔG-Wert bedeutet, dass die Reaktion endergonisch ist und Energie in Form von freier Enthalpie benötigt, ein negativer ΔG-Wert bedeutet, dass die Reaktion exergonisch ist und Energie in Form von freier Enthalpie freisetzt.
  • Wie können endergonische Reaktionen in Organismen ablaufen?

    Lösung

    Endergonische Reaktionen erfordern eine Energiezufuhr, um aus einfachen Molekülen stärker geordnete, komplexere Moleküle aufzubauen. Der zweite Hauptsatz der Thermodynamik besagt, dass die Unordnung im Universum stetig zunimmt. Endergonische Reaktionen sind zeitlich und räumlich mit exergonischen gekoppelt, durch die die Unordnung zunimmt und die die Energie für die endergonischen Reaktionen bereitstellen. Insgesamt gesehen entziehen Organismen ihrer Umwelt freie Enthalpie, um den Fortgang dieser Reaktionen sicherzustellen.
  • Welche chemischen Eigenschaften ermöglichen es dem ATP-Molekül, Energie zu speichern?

    Lösung

    ATP besitzt terminale Phosphatgruppen, die einander abstoßen, sodass Energie notwendig ist, um eine Bindung zwischen ihnen auszubilden. Ein Teil dieser Energie ist als potenzielle Energie gespeichert. Bei der Hydrolyse der Bindungen wird die Energie abgegeben, da die freie Enthalpie der P∽O-Bindung höher ist als die freie Enthalpie der OH-Bindung, die bei der Hydrolyse entsteht.
  • An der folgenden biochemischen Teilreaktion ist ATP beteiligt:
    Phosphoenolpyruvat → Pyruvat (ΔG = +10 kcal/mol)
    a. Ist die Teilreaktion exergonisch oder endergonisch?
    b. Wird ATP im Verlauf der Gesamtreaktion hydrolysiert oder gebildet?

    Lösung

    a. Die Reaktion ist endergonisch (positiver ΔG-Wert).
    b. Die Hydrolyse von ATP kann diese Reaktion antreiben (ΔG = –7,3 kcal/mol).
  • Erläutern Sie, wie die Struktur eines Enzyms ihm seine Spezifität verleiht.

    Lösung

    Enzyme besitzen eine dreidimensionale Raumstruktur (die Tertiärstruktur) mit einem aktiven Zentrum, in das das Substrat genau hineinpasst. Auch binden chemische Gruppen im aktiven Zentrum nichtkovalent an das Substrat.
  • Wie stehen ein Enzym und das chemische Gleichgewicht einer Reaktion miteinander in Beziehung?

    Lösung

    Eine enzymkatalysierte Reaktion läuft rascher in Richtung des Gleichgewichtspunkts ab als eine nichtkatalysierte, der Gleichgewichtspunkt selbst wird jedoch nicht beeinflusst.
  • Geschälte Kartoffeln verfärben sich braun, da das Enzym Polyphenol-Oxidase unter Verbrauch von O2 als Substrat die Oxidation von bestimmten Molekülen katalysiert. Erläutern Sie die folgenden Beobachtungen:
    a. Die Braunfärbung der Kartoffeln ist geringer, wenn die Kartoffeln unter Wasser geschält und dort bis zur Weiterverarbeitung aufbewahrt werden.
    b. Werden Kartoffeln gekocht und anschließend abgekühlt, bleibt die Braunfärbung nach dem Anschneiden aus.

    Lösung

    a. Die Anwesenheit von Wasser könnte das Sauerstoffmolekül (O2) daran hindern, das aktive Zentrum zu erreichen.
    b. Durch das Kochen werden Proteine denaturiert. Die Raumstruktur der Polyphenol-Oxidase wird durch das Kochen irreversibel verändert und das Enzym verliert seine Aktivität.
  • Die chemische Struktur eines Enzyms ändert sich durch die Katalyse nicht, doch im Verlauf der Reaktion kann sich ein Enzym durchaus verändern. Auf welcher Ebene findet diese Veränderung statt und warum?

    Lösung

    Als Teil der Katalyse kann ein Enzym beispielsweise vorübergehend H+ auf das Substrat übertragen oder dieses auch entfernen, wodurch die Reaktion erleichtert werden kann. An dieser Reaktion sind saure oder basische Seitenketten von Aminosäuren im aktiven Zentrum beteiligt. Metallionen können Elektronen aufnehmen oder auch abgeben und sie zeitweilig auf das Substrat übertragen.
  • Vergleichen Sie Enzyme und Cosubstrate (Coenzyme) hinsichtlich ihrer chemischen Struktur und ihrer Funktion miteinander.

    Lösung

    Cosubstrate (Coenzyme) sind klein und keine Proteine, bei Enzymen handelt es sich um Proteine; Cosubstrate katalysierten keine Reaktionen, Enzyme sind Katalysatoren; Cosubstrate übertragen chemische Gruppen (z.B. H+) oder entfernen sie und gehen so verändert aus der Reaktion hervor, Enzyme werden durch die Reaktion nicht dauerhaft verändert.
  • Erstellen Sie ein Diagramm, in dem Sie die Reaktionsgeschwindigkeit gegen die Enzymkonzentration auftragen, und erläutern Sie den Kurvenverlauf.

    Lösung

    Zu Beginn der Reaktion steigt die Reaktionsgeschwindigkeit linear mit der Enzymkonzentration, da alle Enzymmoleküle trotz Zugabe weiterer Enzymmoleküle mit Substrat gesättigt sind. Die Reaktionsgeschwindigkeit nimmt daher proportional zur Anzahl an Enzymmolekülen zu, aber nur, bis die ersten Enzymmoleküle nicht mehr gesättigt sind. Bei dieser Enzymkonzentration ist das Enzym im Hinblick auf das Substrat im Überschuss vorhanden und die Zugabe weiterer Enzymmoleküle steigert die Reaktionsgeschwindigkeit nicht weiter. An diesem Punkt erreicht die Reaktionsgeschwindigkeit ein Plateau, auf dem sie konstant bleibt. Die Maximalgeschwindigkeit ist erreicht.
  • Stellen Sie sich ein Enzym vor, das allosterisch reguliert ist. Wenn ein kompetitiver Inhibitor (kein allosterischer Inhibitor) zur Lösung eines derartigen Enzyms gegeben wird, steigt das Verhältnis von Enzymmolekülen in der aktiven Form und solchen in der inaktiven Form an. Erklären Sie diese Beobachtung.

    Lösung

    Ein kompetitiver Inhibitor bindet an das aktive Zentrum des Enzyms und verschiebt das Gleichgewicht in Richtung der aktiven Enzymmoleküle.
  • Für den Menschen ist Wasserstoffperoxid (H2O2) toxisch, doch es entsteht als Nebenprodukt zahlreicher Stoffwechselwege. Die Anreicherung von H2O2 wird verhindert, indem es in harmloses H2O umgewandelt wird. Katalysiert wird diese Reaktion von dem Enzym Katalase. Die Katalase kann durch Luftverunreinigungen gehemmt werden, wodurch betroffene Menschen eine Empfindlichkeit für Gewebeschädigungen durch H2O2 entwickeln. Wie könnten Sie feststellen, ob die Katalase ein allosterisches oder ein nichtallosterisches Enzym ist und ob die Verunreinigungen als kompetitive bzw. nichtkompetitive Inhibitoren wirken?

    Lösung

    Um festzustellen, ob die Katalase ein allosterisches oder ein nichtallosterisches Enzym ist, müssten Sie ein Experiment durchführen, bei dem Sie zu einer Enzymlösung unterschiedliche Mengen an Substrat geben und jeweils die Reaktionsgeschwindigkeit messen. Anschließend würden Sie ein Diagramm erstellen, in dem Sie die Reaktionsgeschwindigkeit gegen die Substratkonzentration auftragen. Ein s-förmiger Kurvenverlauf wiese auf einen allosterischen Mechanismus hin, verliefe die Kurve hyperbolisch, läge wahrscheinlich ein nichtallosterischer Mechanismus vor. Um festzustellen, ob eine Luftverunreinigung als kompetitiver oder als nichtkompetitiver Inhibitor wirkt, müssten Sie die verunreinigende Substanz zur Enzymlösung geben, um die Reaktionsgeschwindigkeit zu senken, und dann steigende Substratmengen zufügen. Ein kompetitiver Inhibitor würde aus dem aktiven Zentrum verdrängt und die Reaktionsgeschwindigkeit würde steigen. Würde es sich um einen nichtkompetitiven Inhibitor handeln, dann würde die Reaktionsgeschwindigkeit durch die Zugabe des Substrats nicht steigen.
  • Wie lauten die Prinzipien, denen Stoffwechselwege in Zellen folgen?

    Lösung

    In der Zelle findet eine komplexe chemische Umwandlung in einer Reihe von getrennten Reaktionen statt, die einen Stoffwechselweg bilden. Jede Reaktion wird von einem spezifischen Enzym katalysiert. Viele Stoffwechselwege sind in allen Organismen ähnlich, von den Bakterien bis hin zum Menschen. In eukaryotischen Zellen sind viele Stoffwechselwege kompartimentiert, wobei bestimmte Reaktionen häufig nur in bestimmten Organellen stattfinden. In jedem Stoffwechselweg kann ein Schlüsselenzym inhibiert oder aktiviert werden, um den Fluss durch den Stoffwechselweg zu verändern.
  • Erläutern Sie die Funktionen von NADH und O2 in einer Redoxreaktion in Bezug auf die Elektronen.

    Lösung

    NADH ist ein Reduktionsmittel (es gibt Elektronen ab und wird dabei selbst oxidiert), O2 ist ein Oxidationsmittel (es nimmt Elektronen auf und wird dabei selbst reduziert).
  • Die folgende Reaktion ist eine der Reaktionen des Citratzyklus:

    Beantworten Sie die folgenden Fragen und erläutern Sie Ihre Antworten:
    a. Ist diese Reaktion eine Oxidation oder eine Reduktion?
    b. Ist diese Reaktion exergonisch oder endergonisch?
    c. Welche Art von Cosubstratist für diese Reaktion erforderlich?

    Lösung

    a. Es handelt sich um eine Oxidation (die Entfernung von H-Atomen vom C2 und C3 des Succinats).
    b. Da es sich um eine Oxidation handelt, ist es ein exergonischer Prozess.
    c. Die Reaktion erfordert die Redoxcosubstrate NAD+ oder FAD.
  • Wie hoch ist der Nettoenergiegewinn der Glykolyse, wenn man die Energieinvestition in Form von ATP und reduzierten Electronencarriernmit dem Energiegewinn verrechnet?

    Lösung

    Der Nettoenergiegewinn der Glykolyse beträgt 2 ATP und 1 NADH pro Glucosemolekül.
  • Welche Rolle spielt die Oxidation von Pyruvat für den Citratzyklus?

    Lösung

    Die Pyruvatoxidation liefert die aktivierte C2-Verbindung Acetyl-CoA, die als Substrat an der ersten Reaktion des Citratzyklus beteiligt ist.
  • Erläutern Sie, inwiefern der Citratzyklus ein Zyklus ist und die Glykolyse nicht.

    Lösung

    Im Citratzyklus wird die C4-Verbindung Oxalacetat regeneriert, das damit für die Aufnahme einer weiteren Acetylgruppe von Acetyl-CoA bereitsteht. In der Glykolyse wird dagegen keine Ausgangssubstanz regeneriert.
  • Wie werden Protonen während des Elektronentransports aus der mitochondrialen Matrix in den Intermembranraum transportiert?

    Lösung

    Die Elektronen fließen in der inneren Mitochondrienmembran energetisch „bergab“ durch eine Reihe von Elektronencarriern, die Redoxreaktionen durchlaufen. Der Elektronentransport führt an drei dieser Carrier zu einem Transfer von Protonen aus der Matrix energetisch „bergauf“ in den Intermembranraum.
  • Welche Abfolge von Veränderungen, die Redoxreaktionen betreffen, findet in Geweben von Säugetieren statt, wenn das Gewebe von der Sauerstoffversorgung abgeschnitten wird? Die erste Veränderung ist, dass das gesamte Cytochrom c reduziert wird, da Elektronen bis zum Cytochrom c fließen können, von der Cytochrom c-Oxidaseaber nicht auf Sauerstoff übertragen werden können. Was geschieht anschließend?

    Lösung

    Bleibt Cytochrom c reduziert und kann daher keine Elektronen aufnehmen, verbleiben die Elektronentransportkette wie auch NADH und FADH2 in einem reduzierten Zustand. Dadurch werden die Oxidationsreaktionen im Citratzyklus und auch die Oxidation von Pyruvat blockiert, sodass Pyruvat nicht in Acetyl-CoA umgewandelt werden kann. Stattdessen wird aus Pyruvat Milchsäure gebildet und so zumindest ein wenig NAD+ regeneriert, das in der Glykolyse verwendet wird. Da die Elektronentransportkette blockiert ist, wird in den Mitochondrien kein Protonengradient aufgebaut. Die ATP-Synthese durch oxidative Phosphorylierung kommt zum Stillstand.
  • Weshalb ist das Auffüllen des NAD+-Vorrats erforderlich, damit die Glykolyse in Abwesenheit von O2 weiter ablaufen kann?

    Lösung

    NAD+ ist ein Elektronenakzeptor für Reaktionen der Glykolyse und der Pyruvatoxidation. Liegt es nicht in seiner oxidierten Form vor, können die beiden Substrate nicht oxidiert werden und die Stoffwechselwege werden angehalten.
  • Inwiefern wird der NAD+-Vorrat durch die Gärung aufgefüllt?

    Lösung

    Der NAD+-Vorrat wird durch Gärung wieder aufgefüllt, da NADH in diesen Reaktionen, in denen aus Pyruvat Lactat bzw. Ethanol gebildet werden, reoxidiert wird.
  • Nennen Sie Beispiele für Stoffwechselwege, die bei der katabolischen Umwandlungeines Lipids und bei der anabolischen Umwandlung eines Proteins mit der Glykolyse und dem Citratzyklus verbunden sind.

    Lösung

    katabolische Umwandlung eines Lipids: Fettsäuren werden zu Acetyl-CoA abgebaut. Dieses tritt in den Citratzyklus ein und wird zu CO2 oxidiert; die dabei freigesetzte Energie dient der Bildung von NADH und FADH2. Anabolische Umwandlung eines Proteins: Aminosäuren werden in Zwischenprodukte der Glykolyse und des Citratzyklus umgewandelt. Diese Zwischenprodukte können der Synthese von Glucose, Fetten oder anderen Aminosäuren (Proteinsynthese) dienen.
  • Auf welche Art und Weise ist die Phosphofructokinase der Kontrollpunkt für die Glykolyse?

    Lösung

    Die Phosphofructokinase ist zu einem frühen Zeitpunkt in der Glykolyse aktiv. Sie ist der Kontrollpunkt, an dem der Rest des Energiestoffwechsels durch Produkte (ATP, Citrat) abgeschaltet oder durch Metaboliten, die einen Energiebedarf signalisieren (ADP), angeschaltet wird.
  • Nehmen Sie an, Sie äßen ein belegtes Brot, das Polysaccharide, Proteine und Lipide enthält. Wie ist es möglich, dass sich die Kohlenstoffatome der Aminosäuren (aus den Proteinen) und der Glucose (aus den Polysacchariden) später in Ihrem Körperfett wiederfinden?

    Lösung

    Einige Aminosäuren werden in Zwischenprodukte der Glykolyse umgewandelt. In der Glykolyse werden sie zu anderen Zwischenprodukten metabolisiert, die wiederum in Glycerol umgewandelt werden können. Das Glycerol kann für die Synthese von Triacylglycerinen verwendet werden. In der Pyruvatoxidation, die sich der Glykolyse anschließt, wird Acetyl-CoA gebildet, das der Synthese von Fettsäuren dient, die ebenfalls Bestandteil von Triacylglycerinen sind. Glucose wird in der Glykolyse und der Pyruvatoxidation ebenfalls in Acetyl-CoA umgewandelt, das letztlich auch für die Fettsäuresynthese bereitgestellt wird.
  • Wie sind die Lichtreaktionen und die lichtunabhängigen Reaktionen der Photosynthese miteinander verbunden?

    Lösung

    Die Lichtreaktionen wandeln Lichtenergie in chemische Energie um, die in Form von ATP und NADPH gespeichert wird. Die lichtunabhängigen Reaktionen nutzen ATP und NADPH, um die Fixierung von CO2 anzutreiben und daraus Kohlenhydrate zu synthetisieren.
  • Welche experimentellen Befunde gibt es dafür, dass Wasser die Quelle für das in der Photosynthese produzierte O2 ist?

    Lösung

    Wissenschaftler verwendeten das Isotop 18O, um zu zeigen, dass das während der Photosynthese gebildete O2 aus dem Wasser stammt, welches sie mit 18O markiert hatten, und nicht aus dem alternativ markierten CO2.
  • Wie kann ein Pigmentmolekül die Energie eines absorbierten Photons abgeben?

    Lösung

    Ein Pigmentmolekül gibt die Energie eines absorbierten Photons im Allgemeinen ab, indem das angeregte Elektron in den Grundzustand zurückkehrt und die Energie in Form von Licht oder Wärme frei wird. Alternativ kann das angeregte Elektron und damit die Energie auch auf ein anderes Molekül übertragen werden, das dadurch reduziert wird.
  • Wie unterscheidet sich ein Absorptions- von einem Wirkungsspektrum?

    Lösung

    In einem Absorptionsspektrum wird die Stärke der Absorption durch ein Pigment (y-Achse) aufgetragen gegen die Wellenlänge des Lichts, das auf das Pigment auftrifft (x-Achse). In einem Wirkungsspektrum wird die biologische Aktivität (y-Achse) aufgetragen gegen die Wellenlänge des auftreffenden Lichts (x-Achse).
  • Auf welche Weise führt der zyklische Elektronentransport in Photosystem I zur Synthese von ATP?

    Lösung

    Beim zyklischen Elektronentransport erfolgt eine chemiosmotische ATP-Synthese, indem das Elektronentransportsystem in der Thylakoidmembran genutzt wird.
  • Welche Experimente führten zur Identifizierung von 3PG als erstem Produkt der CO2-Fixierung?

    Lösung

    Die Wissenschaftler inkubierten Algen unterschiedlich lange mit 14CO2 und untersuchten anschließend, in welchen Molekülen sie das 14C nachweisen konnten. Nach einem sehr kurzen Zeitraum von 3 s befand sich der gesamte markierte Kohlenstoff im 3-Phosphoglycerat (3PG). Nach einer längeren Inkubationszeit von 30 s war er in mehreren Verbindungen nachweisbar, was darauf hinweist, dass 3PG das erste Produkt der CO2-Fixierung ist und für die Synthese weiterer Moleküle verwendet wird.
  • Über welche Prozesse stimuliert Licht den Calvin-Zyklus?

    Lösung

    In den Lichtreaktionen werden ATP und NADPH gebildet, die für die CO2-Fixierung verwendet werden (Calvin-Zyklus). Durch die lichtinduzierten pH-Wert-Veränderungen im Stroma werden einige Enzyme des Calvin-Zyklus aktiviert. Durch den lichtinduzierten Elektronentransport werden Disulfidbrücken in vier Enzymen des Calvin-Zyklus reduziert, die dadurch aktiviert werden.
  • Der photosynthetische Elektronentransport und der Calvin-Zyklus kommen beide nachts zum Erliegen. Welche spezifische Reaktion hört zuerst auf? Welche als Nächste? Verfolgen Sie diese Ereigniskette so lange, bis Sie erklärt haben, warum beide Stoffwechselwege zum Stillstand gekommen sind.

    Lösung

    Im Dunkeln stoppt der mit der Photosynthese assoziierte Elektronentransport bei Photosystem II → Plastochinol (reduziertes Plastochinon). Anfangs bleiben die Chlorophyllmoleküle in den Antennenkomplexen reduziert, sodass auch die Chlorophylle der Reaktionszentren reduziert vorliegen und PhotosystemII reduziert bleibt. Der Calvin-Zyklus kommt in der Reduktionsphase (Reduktion von 3PG), in der NADPH benötigt wird, zum Erliegen. RuBP wird nicht regeneriert, sodass die Rubisco nicht aktiv ist. Die ersten Reaktionen, die ausbleiben, sind die Oxidation von Photosystem I und die Reduktion von NADP+ zu NADPH.
  • Wie halten C4-Pflanzen die CO2-Konzentration um die Rubiscoherum hoch und warum ist das wichtig?

    Lösung

    In C4-Pflanzen wird das CO2 zunächst in den Mesophyllzellen des Blattes fixiert und anschließend in Form eines C4-Moleküls in die Bündelscheidenzellen transportiert. Dort wird das CO2 durch Decarboxylierung des C4-Moleküls freigesetzt und tritt in den Calvin-Zyklus ein. Die Bündelscheidenzellen sind im Blattinneren lokalisiert, wo sie einer geringeren Konzentration des atmosphärischen O2 ausgesetzt sind, als es in der Nähe der Blattoberfläche der Fall wäre.
  • Beschreiben Sie CAM-Pflanzen und erläutern Sie, wie sie die CO2-Fixierung vorrübergehend von den Reaktionen des Calvin-Zyklus trennen.

    Lösung

    In CAM-Pflanzen erfolgt die CO2-Fixierung in Form einer C4-Verbindung (Malat) bei Nacht, wenn die Stomata aufgrund der niedrigeren Temperaturen und des geringeren Wasserverlusts geöffnet sind. Tagsüber, wenn die Stomata geschlossen sind, um den Wasserverlust niedrig zu halten, und die Lichtreaktionen ATP und NADPH bereitstellen, wird das angereicherte Malat aus der Vakuole in die Chloroplasten transportiert. Dort wird es decarboxyliert und das freigesetzte CO2 tritt in den Calvin-Zyklus ein.
  • Auf welche Art und Weise sind die Stoffwechselwege der Glykolyse, des Citratzyklus und der Photosynthese über gemeinsame Zwischenprodukte miteinander verbunden?

    Lösung

    3PG und G3P verbinden den Calvin-Zyklus und die Glykolyse miteinander, Acetyl-CoA verbindet die Glykolyse mit dem Citratzyklus.
  • Warum werden nur 5 % des auf die Erde auftreffenden Sonnenlichts in pflanzliches Wachstum umgesetzt?

    Lösung

    Der größte Anteil des Sonnenlichts wird von den Pflanzen nicht absorbiert, zum einen, weil die Wellenlängen nicht Teil des Absorptionsspektrums der pflanzlichen Pigmente sind, zum anderen, weil es ins All reflektiert wird und auch, da es aufgrund der pflanzlichen Morphologie nicht absorbiert wird und auf den Boden auftrifft.
  • Wodurch ist im Allgemeinen die Fortpflanzung einer prokaryotischen Zelle durch binäre Spaltungbegrenzt?

    Lösung

    Mangel an Nährstoffen ist häufig ein Signal für das Auslösen einer binären Spaltung.
  • Warum muss die DNA repliziert werden und segregieren, bevor sich die Zelle teilen kann?

    Lösung

    Wenn sich die Zelle teilen würde, bevor die DNA vollständig repliziert ist, würde keine neue Zelle ein vollständiges Äquivalent der DNA als genetisches Material erhalten.
  • Warum sind die DNA-Replikation und die Zellteilung bei Eukaryoten komplizierter als bei Prokaryoten?

    Lösung

    Eukaryoten enthalten mehr DNA, die DNA liegt in mehreren Molekülen vor, die DNA-Moleküle sind viel größer und die DNA befindet sich in einem abgetrennten Zellkompartiment, dem Zellkern.
  • Wie können die Cyclin/Cdk-Komplexe den Fortschritt des Zellzyklus regulieren?

    Lösung

    Die Cdks werden während des gesamten Zellzyklus produziert. Jedoch ist das aktive Zentrum der Proteinkinase nicht für die Substrate der Zellzyklusaktivitäten zugänglich, solange nicht ein bestimmtes Cyclinmolekül an die Cdk bindet. Die Cycline werden produziert, binden an die Cdks und werden dann abgebaut. Das temporäre Auftreten der Cycline kontrolliert die Aktivierung aller Cdks in der richtigen Reihenfolge an den Kontrollstellen des Zellzyklus.
  • Was sind Wachstumsfaktoren und wie wirken sie bei der Kontrolle des Zellzyklus mit?

    Lösung

    Wachstumsfaktoren sind Proteine, die von Zellen produziert werden und zu anderen Zellen gelangen können oder auch auf diejenigen Zellen einwirken, die sie hervorbringen. Normalerweise stimulieren sie die Zellteilung. Wachstumsfaktoren binden an spezifische Rezeptoren auf ihren Zielzellen und setzen in diesen Zellen einen Signalübertragungsweg in Gang. Dadurch kann es beispielsweise zur Genexpression von Cyclinen kommen, sodass der Zellzyklus stimuliert wird.
  • Das Protein p16 wirkt auf den Zellzyklus ähnlich wie p21. Vor Kurzem hat man festgestellt, dass es bei älteren Menschen in den Zellen mehr p16 gibt als bei jüngeren Menschen. Was lässt sich daraus für den Alterungsprozess schließen?

    Lösung

    p16 blockiert die Wechselwirkung zwischen einem Cyclin und der zugehörigen Cdk. Wenn ältere Menschen mehr p16 produzieren, kann dies dazu führen, dass ihr Zellzyklus blockiert wird und Gewebeschäden nicht mehr durch das Ersetzen von Zellen behoben werden können.
  • Wie unterscheiden sich Ausgangschromosom, Chromatid und Tochterchromosom und welche Bedeutung haben sie jeweils bei der Zellteilung?

    Lösung

    Ein Chromosom ist ein DNA-Molekül mit assoziierten Proteinen. Wenn die Zelle in die Mitose eintritt, bildet das Chromosom mit weiteren Proteinen einen Komplex und kondensiert sehr stark, sodass eine lichtmikroskopisch sichtbare Struktur entsteht. Ein Chromatid ist das Produkt der DNA-Replikation während der S-Phase. Chromatiden liegen paarweise vor – als Schwesterchromatiden, die zusammen ein Zwei-Chromatid-Chromosom bilden. Bis zur Anaphase der Mitose sind sie am Centromer miteinander verbunden. In der Anaphase der Mitose werden die Schwesterchromatiden getrennt und so zu Tochterchromosomen, bei denen es sich um Ein-Chromatid-Chromosomen handelt.
  • Welche verschiedenen Ebenen der Verpackung gibt es, durch die lineare DNA während der Prophase verdichtet (kondensiert) wird?

    Lösung

    Während der Interphase ist die DNA durch Histonproteine zu Nucleosomen kondensiert, die sich übereinander falten und so die Chromatinfasern bilden. Während der Prophase heften sich die Fasern in Form von Schleifen an weitere Proteine, welche die Schleifenbildung noch intensivieren und so das schließlich das Metaphasechromosom ausbilden.
  • Paclitaxelist ein Wirkstoffgegen Krebs, deran Mikrotubuli bindet und verhindert, dass Untereinheiten hinzugefügt oder entfernt werden. Zudem führt Paclitaxel dazu, dass die vorhandenen Mikrotubuli Aggregatebilden. Wie kann der Wirkstoff Ihrer Meinung nach das Tumorwachstum zum Stillstand bringen? Ist Paclitaxel für Krebszellen spezifisch?

    Lösung

    Die Schwesterchromatiden eines Chromosoms werden über Spindelmikrotubuli mit dem jeweils näher gelegenen Zellpol verbunden. Molekulare Motoren auf den Mikrotubuli bewegen die Schwesterchromatiden auseinander und zum jeweiligen Pol hin. Unterstützend verkürzen sich die Spindelmikrotubuli von den Polen her. Paclitaxel blockiert diese Vorgänge und hemmt dadurch die Mitose. Der Wirkstoff hemmt auch die Zellteilung normaler Zellen, die in die M-Phase eintreten.
  • Wie unterscheidet sich die Cytokinese bei Pflanzen-und Tierzellen?

    Lösung

    Bei Pflanzenzellen bildet sich aus Golgi-Vesikeln eine neue Zellwand, welche die beiden Tochterzellen trennt. Beiderseits der Zellwand entwickelt sich das fehlende Stück Plasmamembran. Bei Tierzellen entsteht am Äquator eine Einschnürung durch Actinfilamente, sodass sich die Plasmamembran schließlich ganz abschnürt und die Zellen sich entweder trennen oder komplett membranumhüllt aneinander haften bleiben.
  • Was geschieht imZellzyklus, wenn das Protein Cohesin funktionslos ist?

    Lösung

    Würde die Kohäsion nicht funktionieren, könnten sich die Chromatiden während der Zellteilung nicht so eng zusammenlagern, und es würde sich kein Centromer bilden. Die beiden Chromatiden würden sich trennen und es gäbe keine organisierte Anheftung an den jeweiligen Zellpol. Die Verteilung der Schwesterchromatiden eines Chromatidpaares auf die beiden Tochterzellen wäre gestört.
  • Wie entsteht in Bezug auf die Chromosomen durch die Befruchtung ein diploider Organismus und wie lässt sich erkennen, ob eine Zelle diploid ist?

    Lösung

    Dafür betrachtet man die Chromosomen einer sich teilenden Zelle. Wenn sich alle Chromosomen in der Größe und Positionierung des Centromers voneinander unterscheiden, handelt es sich um eine haploide Pflanze. Wenn zwei Kopien von jedem Chromosom vorhanden sind, handelt es sich um eine diploide Pflanze.
  • Welche allgemeinen Merkmale sind allen geschlechtlichen Lebenszyklen gemeinsam?

    Lösung

    Bei der Befruchtung kommt es zur Vereinigung zweier haploider Gameten, wobei jeder einen einfachen Chromosomensatz beisteuert, der in der Meiose gebildet wurde. Deshalb ist die befruchtete Zelle diploid.
  • Wie würden Sie bei einer Probe von einer kleinen Grünpflanze feststellen, ob sie haploid oder diploid ist?

    Lösung

    Alle geschlechtlichen Lebenszyklen umfassen ein haploides und ein diploides Zellstadium, es kommt zu einer Meiose und zu einer Befruchtung.
  • Wie entstehen durch Crossing-over und die unabhängige Verteilung die individuellen Tochterkerne?

    Lösung

    Beim Crossing-over wird genetisches Material zwischen den nichtidentischen Partnern in einem Chromosomenpaar ausgetauscht. Die so entstehenden Chromosomen tragen nun neue Genkombinationen, die durch die Gameten bei der Befruchtung an die Nachkommen weitergegeben werden können. Bei einer unabhängigen Verteilung erfolgt die Verteilung der Chromosomen eines homologen Paares auf die einzelnen Gameten zufällig. So besitzen die Gameten jeweils unterschiedliche Chromosomensätze. Das heißt, Chromosom 1 stammt vielleicht vom Vater, Chromosom 2 von der Mutter und so weiter. Die Befruchtung bringt eine diploide Zelle hervor, die eine genetisch neuartige Zusammenstellung von Erbanlagen enthält.
  • Vergleichen Sie die Prophase I der Meiose mit der Prophase der Mitose. Vergleichen Sie die Anaphase I der Meiose mit der Anaphase der Mitose.

    Lösung

    Prophase I der Meiose: Chromosomen bestehen aus aneinander befestigten Chromatidpaaren, und die beiden Homologen sind Gen für Gen aneinandergelagert. Anaphase I der Meiose: Homologe Chromosomen, die jeweils aus zwei zusammengelagerten Chromatiden bestehen, trennen sich und wandern zu den Polen. Anaphase der Mitose: Schwesterchromatiden werden getrennt, werden so zu einzelnen Tochterchromosomen und wandern zu den Polen.
  • In seltenen Fällen wird ein Mensch mit einem zusätzlichen X-Chromosom (XXY) geboren. Wie entsteht eine solche Aneuploidie?

    Lösung

    Bei der Bildung der männlichen Gameten werden das X- und das Y-Chromosom während der Anaphase I der Meiose nicht voneinander getrennt. Am Ende der Meiose II gibt es zwei Arten von Gameten: die Hälfte ohne ein X oder ohne ein Y, und die andere Hälfte mit X und Y. Wenn letztere eine normale Eizelle mit einem einzigen X-Chromosom befruchten, trägt der Nachkomme die Kombination XXY. Wenn es jedoch bei der Bildung der weiblichen Gameten zu einer entsprechenden Nondisjunktion kommt, entstehen Eizellen mit zwei X-Chromosomen. Wenn die XX-Eizelle von einem normalen Y-Spermium befruchtet wird, trägt der Nachkomme ebenfalls die Kombination XXY.
  • Was ist Polyploidie und wie kommt es dazu?

    Lösung

    Mit Polyploidie bezeichnet man den Zustand, wenn der Chromosomensatz triploid (3n), tetraploid (4n) oder noch größer ist. Dazu kommt es, wenn die Chromosomenpaare bei der Gametenbildung in der Meiose nicht in Einzelchromosomen getrennt werden, sodass beispielsweise ein diploider Gamet entsteht.
  • Welche Art von Ereignissen löst eine Nekrose aus und wie unterscheiden sich diese von Ereignissen, die die Apoptose in Gang setzen?

    Lösung

    Ursachen für eine Nekrose sind beispielsweise eine mechanische Schädigung oder Nährstoffmangel.
  • In welchen Situationen ist die Apoptose unbedingt notwendig?

    Lösung

    Die Apoptose ist zum Beispiel notwendig, wenn eine Zelle mutiert ist, oder wenn ein Gewebe zu viele Zellen enthält.
  • Wie wird die Apoptose reguliert?

    Lösung

    Die Apoptose wird durch Signale wie Hormone oder DNA-Schäden und durch einen Signalübertragungsweg reguliert, der die apoptotischen Vorgänge einleitet.
  • Vergleichen Sie Zellen und Gene im normalen Gewebe, in bösartigen Tumoren und in gutartigen Tumoren.

    Lösung

    Normale Zellen kontrollieren die Zellteilung und bleiben in ihrem Gewebe. Bösartige Tumorzellen verlieren die Kontrolle über die Zellteilung und wandern in andere Körperregionen. Gutartige Tumorzellen verlieren die Kontrolle über die Zellteilung, hören aber zu einem bestimmten Zeitpunkt auf sich zu teilen; sie wandern nicht in andere Körperregionen.
  • Wie sind Onkogenproteine und Tumorsuppressorproteine an der Kontrolle des Zellzyklus beteiligt?

    Lösung

    In normalen Zellen sind Onkogenproteine nicht aktiv oder werden nur in geringen Mengen synthetisiert. In Krebszellen werden Onkogenproteine hingegen in größeren Mengen oder in mutierter Form erzeugt und stimulieren so den Zellzyklus. In normalen Zellen werden Tumorsuppressorproteine erzeugt und blockieren aktiv den Zellzyklus. In Krebszellen sind Tumorsuppressorproteine entweder mutiert und damit funktionslos oder sie werden nicht gebildet. In beiden Fällen sind sie nicht aktiv, um die Zellteilung zu blockieren. So teilen sich die Zellen und bilden Tumoren.
  • Krebstherapeutika werden normalerweise in Kombination verabreicht, um in mehrere Stadien des Zellzyklus einzugreifen. Warum ist das ein besserer Ansatz als wenn man nur einen Wirkstoff verwenden würde?

    Lösung

    Krebszellen sind im Zellzyklus nicht synchronisiert. Zu einem bestimmten Zeitpunkt befinden sich einige in der G1-Phase, einige in der S-Phase und so weiter. Es erscheint also günstiger, alle Phasen anzugreifen und nicht nur eine.
  • Welche Ergebnisse für die F1- und F2-Generation bei Mendels Monohybridenkreuzungen führten dazu, dass die Vermischungshypothese verworfen wurde?

    Lösung

    Die F1-Generation zeigte nur einen der elterlichen Phänotypen. Bei einer „Vermischung“ würde die F1-Generation einen intermediären Phänotyp aufweisen, aber keinen der Eltern. Die F2-Generation zeigte auch den Phänotyp des anderen Elters, der in der F1-Generation nicht auftrat. Gemäß der Vermischungshypothese müsste dieser jedoch verschwinden.
  • Bei Meerschweinchen ist die schwarze Fellfarbe (B) gegenüber der Albinoform (b) vollständig dominant. Welche Genotypen haben die Eltern bei den folgenden Kreuzungsexperimenten?

    Lösung

    BB × bb; bb × bb; Bb × bb; Bb × Bb
  • Der unten dargestellte Stammbaum zeigt das Vererbungsmuster des Phänotyps Grauer Star, einer seltenen Mutation beim Menschen (schwarze Symbole).

    a. Wird der Graue Star als autosomal-dominante oder autosomal-rezessive Merkmalsform vererbt?
    b. Person 5 in der zweiten Generation heiratet einen Mann, der nicht am Grauen Star leidet. Zwei ihrer vier Kinder, ein Junge und ein Mädchen, entwickeln Grauen Star. Wie groß ist die Wahrscheinlichkeit, dass das nächste Kind ein Mädchen mit Grauem Star ist?

    Lösung

    a. autosomal-dominant
    b. 1/4
  • Wie unterscheiden sich Codominanz und unvollständige Dominanz?

    Lösung

    Bei codominanter Vererbung treten bei Heterozygotie beide Allele im Phänotyp hervor. Bei unvollständiger Dominanz entsteht bei Heterozygotie ein intermediärer Phänotyp zwischen beiden Eltern.
  • Warum ist die Blutgruppe AB das Ergebnis einer Codominanz?

    Lösung

    Bei der Blutgruppe AB werden sowohl das A-Allel als auch das B-Allel exprimiert. Auf den meisten Erythrocyten kommen daher beide Proteine vor.
  • Bei einer bestimmten Pflanzenart kontrollieren zwei Allele die Blütenfarbe, die gelb, grün oder blau sein kann. Kreuzungen dieser Pflanzen führen zu folgenden Nachkommen:

    Welche Phänotypen treten bei den Nachkommen der Kreuzung grün x grün in welchem Verhältnis auf?

    Lösung

    gelb, blau und weiß im Verhältnis 1:2:1
  • Wie unterscheiden sich Penetranz und Expressivität?

    Lösung

    Mit Penetranz bezeichnet man den Anteil von Individuen mit einem bestimmten Genotyp, der tatsächlich den Phänotyp hervorbringt, welcher mit dem Genotyp zusammenhängt. Das heißt, welcher Anteil der Erbsenpflanzen mit dem Genotyp „großwüchsig“ zeigt tatsächlich eine entsprechende Pflanzengröße? Mit Expressivität bezeichnet man das Ausmaß, mit dem ein Genotyp den zugehörigen Phänotyp ausprägt. Das heißt, zeigen alle Erbsenpflanzen mit dem Genotyp „großwüchsig“ dieselbe Größe oder gibt es Abstufungen?
  • Wie unterscheiden sich die quantitativen von den qualitativen Merkmalen?

    Lösung

    Die qualitative Variabilität betrifft Phänotypen wie Farbe oder Oberflächenbeschaffenheit, deren Ausmaß man nicht messen kann, beispielsweise grüne und gelbe Erbsen. Die quantitative Variabilität bezieht sich auf Phänotypen, deren Ausmaße sich messen lassen, beispielsweise großwüchsige und kleinwüchsige Erbsenpflanzen.
  • Wenn das dominante Allel A für das menschliche Hörvermögen notwendig ist, und das Allel B, das auf einem anderen Chromosom liegt, zu Gehörlosigkeit führt, unabhängig davon, welche weiteren Gene vorhanden sind, wie hoch ist dann bei Eltern mit aaBb x Aabb der Anteil der gehörlosen Nachkommen?

    Lösung

    75%
  • Beschreiben Sie das Prinzip der genetischen Kopplung und deren Auswirkung auf genetische Kreuzungen.

    Lösung

    Bei einer genetischen Kopplung werden die Allele auf demselben Chromosom im Allgemeinen bei der Gametenbildung zusammen weitergegeben. Das heißt, wenn bei einem heterozygoten Genotyp AaBbA und B auf demselben Chromosom liegen (entsprechend a und b auf dem anderen Chromosom), tragen die Gameten AB oder ab.
  • Wie unterscheidet sich das Verhalten eines geschlechtsgekoppelten Gens bei genetischen Kreuzungen von einem Gen auf einem Autosom?

    Lösung

    Ein geschlechtsgekoppeltes Gen befindet sich auf dem X-Chromosom. Wenn es bei einem Organismus mit dem XY-System der Geschlechtsdifferenzierung zu einer Paarung kommt, gibt es für ein geschlechtsgekoppeltes Gen auf dem X-Chromosom im Allgemeinen kein Gegenstück auf dem Y-Chromosom. So werden bei einem XY-Männchen alle X-gekoppelten Allele, seien sie dominant oder rezessiv, im Phänotyp exprimiert.
  • Die Leberschehereditäre (erbliche) Optikusneuropathiewird durch eine Mutation in einem Gen hervorgerufen, das in der mitochondrialen DNA liegt. Welchen Phänotyp hätte das erste Kind eines Elternpaares, wenn der Vater an dieser Erkrankung leidet, die Mutter dagegen nicht? Welcher Phänotyp wäre zu erwarten, wenn die Mutter erkrankt wäre, aber der Vater nicht?

    Lösung

    Da das Gen auf der mitochondrialen DNA liegt, wird es nur von der Mutter weitergegeben. Die Mutter ist also nicht von der Krankheit betroffen, aber der Vater. Das gemeinsame Kind ist nicht betroffen. Wenn jedoch die Mutter erkrankt ist und nicht der Vater, ist das Kind auch erkrankt.
  • Welche genetische Bedeutung haben Paarung und Rekombination bei den Bakterien?

    Lösung

    Durch Paarung und Rekombination können Gene zwischen Bakterien ausgetauscht werden, was bei diesen Organismen zu genetisch vielfältigen Populationen führt. Da sie haploid sind, wird jede neue Genkombination von den rekombinanten Nachkommen exprimiert.
  • Welche Folgen kann es haben, wenn ein Plasmid in das Hauptchromosom einer prokaryotischen Zelle integriert wird?

    Lösung

    Ein Plasmid, das sich in das Wirtschromosom integriert, bleibt stabil erhalten, wenn sich die Zelle teilt, sodass alle Gene auf dem Plasmid exprimiert werden. Darüber hinaus können die Gene auf dem Plasmid bei der Konjugation des Bakteriums auf die andere Zelle übertragen werden.
  • Wie breiten sich Antibiotikaresistenzen über Plasmide aus?

    Lösung

    Plasmide können Gene tragen, die eine Antibiotikaresistenz vermitteln. Wenn ein Bakterium, das ein Plasmid trägt, sich mit einem anderen paart, das keines hat, wird das Plasmid repliziert und eine der Kopien auf das Empfängerbakterium übertragen. Nun gibt es zwei Bakterien mit der Antibiotikaresistenz.
  • Welche Indizien gab es in den 1920er-Jahren, als Griffith sein Experiment durchführte, dass DNA das genetische Material sein könnte?

    Lösung

    Die DNA befand sich im Zellkern der eukaryotischen Zelle, wo die Chromosomen liegen, die die Gene tragen. In den somatischen Zellen eines Organismus ist dieselbe DNA-Menge vorhanden. Bei der Meiose wird die DNA-Menge halbiert, wie aufgrund des genetischen Materials zu erwarten ist. Verschiedene Spezies verfügen über unterschiedliche Mengen an DNA, wie auch aufgrund der unterschiedlichen Anzahl von Genen nachvollziehbar ist.
  • Wie ließ sich durch das Experiment von Avery und seiner Gruppe ausschließen, dass Proteine das genetische Material bilden?

    Lösung

    Avery und seine Mitarbeiter nahmen für ihre genetischen Experimente Zellextrakte von dem einen Bakterienstamm (A), um damit den Empfängerstamm (B) zu verändern, der sich genetisch von A unterschied. Wenn man den Extrakt des Spenderstamms mit Enzymen behandelte, die die Proteine hydrolysierten, fand die Transformation weiterhin statt. Deshalb konnten die Proteine des Spenderextrakts nicht für die genetische Transformation verantwortlich sein.
  • Welche Eigenschaften des Bakteriophagen T2 waren entscheidend für die Hershey-Chase-Experimente, mit denen sich zeigen ließ, dass DNA und nicht Protein das genetische Material bildet?

    Lösung

    Der Bakteriophage T2 enthält nur zwei Arten von Molekülen: DNA und Proteine. Wenn man die eine oder die andere Molekülart markiert, sollte dies Hinweise darauf geben, welche von beiden in die Wirtszelle gelangt und die genetischen Veränderungen hervorruft.
  • Skizzieren Sie eine Versuchsreihe, um mithilfe radioaktiver Isotope (etwa 32P und 35S) zu zeigen, dass nicht Protein, sondern DNA von der Spender- in dieEmpfängerzelle übertragenwird und sofür die Transformation der Bakterien verantwortlich ist.

    Lösung

    Bei diesen Experimenten ließe sich mithilfe des S-Stamms von Peumococcus der R-Stamm transformieren. Dafür werden getrennte Kulturen von Bakterien des S-Stamms mit 32P oder 35S inkubiert und daraus zellfreie Extrakte des S-Stamms hergestellt. Diese inkubiert man mit dem R-Stamm und testet auf Transformation zum S-Phänotyp. Dann wird festgestellt, ob sich in den neu transformierten Zellen die 32P- oder die 35S-Markierung befindet. Es ist zu erwarten, dass nur die 32P-Markierung in die Zellen gelangt.
  • Nennen Sie die Befunde, die Watson und Crick dazu veranlassten, für die DNA das Modell einer Doppelhelix zu entwickeln.

    Lösung

    Röntgenbeugungsexperimente lieferten den Hinweis darauf, dass DNA doppelsträngig und zu einer Helix verdrillt ist. Die Ergebnisse deuteten auch darauf hin, dass die Basen innerhalb der Helix liegen, die Zucker- und Phosphatgruppen dagegen nach außen zeigen. Die Basenzusammensetzung zahlreicher Organismen zeigte, dass der Anteil des Purins A gleich dem Anteil des Pyrimidins T und der Anteil des Purins G gleich dem Anteil des Pyrimidins C ist. Das deutete darauf hin, dass im Inneren der Doppelhelix A gegenüber von T und G gegenüber von C liegt. Als Watson und Crick ihr Molekülmodell eines Polynucleotiddoppelstrangs bauten, stellten sie fest, dass sie diese Basenpaarungsregel tatsächlich einhalten mussten.
  • Inwieweit steht die Doppelhelixstruktur der DNA im Zusammenhang mit ihrer Funktion?

    Lösung

    Die doppelsträngige Struktur bildet die Grundlage für die DNA-Replikation, da der jeweils gegenüberliegende Strang als Matrize für einen neuen Strang dienen kann, sodass zwei neue identische Stränge erzeugt werden. Dies ist entscheidend für die Replikation des genetischen Materials, wenn sich Zellen teilen. Die beiden Stränge verlaufen so, dass die Basen für die Genexpression zugänglich sind, obwohl sie innen liegen. Das ist wichtig, weil Gene abgelesen werden müssen, damit sich der Phänotyp manifestieren kann.
  • Damit die in der DNA enthaltene Information auf die Zelle wirken kann, müssen weitere Moleküle, etwa Proteine, an spezifische Basensequenzen in der Doppelhelix binden. Wie können spezifische Wechselwirkungen zwischen Proteinen und DNA stattfinden, wenn man die Kräfte, die bei Proteinwechselwirkungen eine Rolle spielen, und die chemischen Gruppen, die bei den Basenpaaren zugänglich sind in Betracht zieht?

    Lösung

    An den Basen der DNA sind funktionelle Gruppen für Wechselwirkungen mit funktionellen Gruppen von Proteinen zugänglich. Dazu gehören polare Gruppen (etwa C=O) von Basen, die entgegengesetzt polare Gruppen von Proteinen (etwa NH2) anziehen; außerdem bilden sie Wasserstoffbrücken mit entsprechenden Gruppen auf den Proteinen.
  • Wie ließ sich mit dem Experiment von Meselson und Stahl zwischen den drei Modellen der DNA-Replikation unterscheiden?

    Lösung

    Bei den Bakterien wurden vorher beide DNA-Stränge mit dem schweren 15N-Isotop markiert, nach einer Replikationsrunde dann mit dem leichten Isotop 14N. Die drei sich gegenseitig ausschließenden Modelle der DNA-Replikation kommen zu folgenden Vorhersagen:
    a. Konservativ: Dabei würden die ursprüngliche DNA (nur mit dem schwerem Isotop) und die neue DNA (nur mit dem leichten Isotop) in gleichen Mengen auftreten. Das war nicht der Fall.
    b. Dispersiv: Hier würden leichte, schwere und intermediäre DNA-Formen in variablen Mengenverhältnissen auftreten. Auch das war nicht der Fall.
    c. Semikonservativ: Dabei sollte nur die intermediäre DNA-Form vorkommen, die aus einem leichten und einem schweren Strang besteht. Das war das Ergebnis.
  • Nennen Sie fünf Proteine, die für die DNA-Replikation notwendig sind. Welche Funktionen besitzen sie?

    Lösung

    Die fünf Proteine, die bei der DNA-Replikation die Hauptrolle spielen, sind DNA-Helikase (entspiralisiert die Doppelhelix), einzelstrangbindende Proteine (stabilisieren die Einzelstränge in den entspiralisierten Regionen und halten sie voneinander getrennt), Primase (bindet an DNA und erzeugt einen kurzen Primer), DNA-Polymerase (hängt Nucleotide an die wachsende Kette) und DNA-Ligase (verknüpft Einzelstrangbrüche in der DNA, die aufgrund der Replikation des Folgestrangs in Form kurzer Fragmente entstehen).
  • Warum befinden sich an den Enden der Chromosomen besondere Sequenzen und wie werden sie repliziert?

    Lösung

    Die speziellen Sequenzen an den Enden der Chromosomen bezeichnet man als Telomere; sie können bei Bedarf repliziert werden. Nach der DNA-Replikation werden die Primerregionen an den 3'-Enden der langen DNA in den Chromosomen entfernt. Dadurch verkürzt sich die DNA bei jeder Replikation etwas, und das führt schließlich zur Apoptose. In einigen Zellen, etwa in Urkeimzellen oder Tumorzellen, werden die Telomersequenzen von dem Enzymkomplex Telomerase erkannt; das Enzym katalysiert die Replikation verloren gegangener Sequenzen und die ursprüngliche Länge der DNA bleibt erhalten.
  • Der Wirkstoff Didesoxycytidin, der zur Behandlung bestimmter Virusinfektionen eingesetzt wird, ist ein Nucleotid mit einer 2',3'-Didesoxyribose. Dieses Zuckermolekül trägt weder an der 2'- noch an der 3'-Position eine –OH-Gruppe. Erklären Sie, warum das Molekül die Verlängerung eines DNA-Strangs beendet, wenn es in DNA eingebaut wird.

    Lösung

    Bei der DNA-Replikation werden an das 3'-Ende der DNA neue Nucleotide angehängt, wo sich an der 3'-Position des Zuckers eine –OH-Gruppe befindet. Wenn diese Gruppe nicht vorhanden ist, kann es zu keiner Kondensationsreaktion kommen und es wird mit dem nächsten Nucleotid keine Bindung gebildet, sodass die Replikation endet.
  • Eine bestimmte Form von Dickdarmkrebs wird durch eine Mutation in einem Gen für ein Protein hervorgerufen, das bei der Reparatur von Fehlpaarungen eine Rolle spielt. Wie würde sich eine solche Mutation auf die Entwicklung von Krebs auswirken? Bedenken Sie hier auch die Bedeutung von Kontrollgenen des Zellzyklus.

    Lösung

    Wenn die Dickdarmkrebszelle eine Mutation im Tumorsuppressorgen trägt, würde dieser Fehler wahrscheinlich nicht repariert, sodass es zu unkontrollierten Zellteilungen kommen kann.
  • Welche Funktion haben die Primer in der PCR?

    Lösung

    Bei der PCR binden Primer eine kurze DNA-Region und ermöglichen so die Verlängerung dieses DNA-Strangs, wenn man eine DNA-Polymerase und Nucleotide zusetzt.
  • Mithilfe der PCR ist es möglich, eine Organismenart in der freien Natur schnell zu identifizieren: Wenn man eine spezifische DNA-Sequenz amplifizieren kann, lässt sich der Organismus bestimmen. Man nennt dies DNA-Barcoding. Worauf basiert dieser Test?

    Lösung

    Wenn die Nucleotidsequenzen der beiden Primer in der DNA einer bestimmten Organismenart vorkommen und sind sie für diese Art spezifisch, dann amplifiziert die PCR in einer Freilandprobe das betreffende DNA-Fragment, wenn die Organismenart in der Probe vorhanden ist. Fehlt der Organismus, bleibt die Amplifikation aus.
  • Was ist ein Modellorganismus, und warum ist Neurospora ein geeigneter Modellorganismus für molekulargenetische Untersuchungen?

    Lösung

    Ein Modellorganismus lässt sich im Labor einfach vermehren und verändern und er besitzt typische Merkmale einer größeren Gruppe von Lebewesen. (Beispielsweise steht die Maus für Säuger.)
  • Wie wurden die Experimente mit Neurospora aufgebaut, um die Reihenfolge der Schritte in einem biochemischen Reaktionsweg zu ermitteln?

    Lösung

    Srb, Horowitz, Beadle und Tatum haben den Neurospora-Wildtyp mit Röntgenstrahlen behandelt, um Mutationen hervorzurufen. Stämme, die nicht mehr ohne Zusatz einer bestimmten Aminosäure (Arginin) wachsen konnten, wurden isoliert. Die Stämme wurden getrennt ohne Arginin, aber mit verschiedenen Zwischenprodukten des Synthesewegs für Arginin inkubiert. Wachstum mit einem der Zwischenprodukte bedeutete, dass die Mutation in diesem Stamm in einem Gen liegen muss, das ein Enzym codiert, welches im Syntheseweg vor diesem Zwischenprodukt aktiv ist. So ist es mit einer Reihe von mutierten Stämmen gelungen, die Zwischenprodukte des Synthesewegs und ihre Reihenfolge zu bestimmen und schließlich das jeweilige Enzym zu identifizieren, das ein bestimmtes Zwischenprodukt in das nächste umwandelt.
    Enzyme: 4 → 2 → 3 → 1 → 5
    Moleküle: C → F → E → D → G → T
  • Wie lautet die zentrale Regel der Molekularbiologie?

    Lösung

    Die zentrale Regel besagt: DNA wird in RNA transkribiert, die dann in Protein translatiert wird; dieser Prozess verläuft nicht in die Gegenrichtung.
  • Verletzen Retroviren die zentrale Regel? Begründen Sie Ihre Antwort.

    Lösung

    Bei den Retroviren besteht das Genom aus RNA. Für die Replikation wird die RNA in eine DNA-Kopie umgewandelt, die dann in RNA transkribiert wird. Dies entsprach nicht der zentralen Regel, bei der man davon ausging, dass der Informationsfluss stets von DNA zu RNA geht und nicht umgekehrt.
  • Erläutern Sie, warum der genetische Code aus Nucleotidtripletts (z.B. AUA) und nicht aus einzelnen Nucleotiden (z.B. A) oder aus Nucleotidpaaren (z.B. AU) besteht.

    Lösung

    Wenn der Code nur aus einzelnen Buchstaben (A oder T oder G oder C) bestehen würde, könnte jeder Buchstabe nur in eine einzige Aminosäure translatiert werden (41). Es gibt jedoch 20 Aminosäuren, sodass ein Ein-Buchstaben-Code nicht alle Aminosäuren eindeutig abbilden könnte. Mit einem Zwei-Buchstaben-Code gäbe es 16 mögliche Codons (42), die aber ebenfalls für die 20 Aminosäuren nicht ausreichen würden. Ein Triplettcode, der auf allen vier Buchstaben basiert, ermöglicht 64 spezifische Kombinationen (43), die wiederum für 20 Aminosäuren und drei Stoppcodons mehr als ausreichen. Der Code ist redundant (d.h., es gibt mehr als ein Codon pro Aminosäure), aber nicht uneindeutig (d.h. ein einzelnes Codon steht nicht für mehr als eine Aminosäure).
  • Beschreiben Sie die Aktivitäten der RNA-Polymerase während der Transkription.

    Lösung

    Die RNA-Polymerase bindet am Promotor an die DNA. Die DNA wird entspiralisiert und ihre Basen werden zugänglich. Das Enzym enthält Bindungsstellen für die Substrate, die Ribonucleosidtriphosphate. Das Enzym hängt dann über komplementäre Basenpaarung mit der Matrizen-DNA Nucleotide an die wachsende Kette.
  • Bei der Transkription kommt es etwa 10. 000-mal häufiger zu Fehlern als bei der DNA-Replikation Warum ist diese hohe Fehlerrate bei der Synthese von RNA tolerierbar, aber nicht bei der von DNA?

    Lösung

    DNA muss exakt repliziert werden. Jeder Fehler in einem proteincodierenden Gen führt zu einem Fehler in jedem RNA-Molekül, das von der DNA-Region transkribiert wird. Dadurch könnte ein verändertes Codon an der entsprechenden Position im Protein eine andere Aminosäure hervorbringen, wodurch sich die Funktion des Proteins verändern könnte. RNA wird in vielen Kopien produziert. Ein Fehler in nur einem RNA-Molekül kann in dem Protein, das von dieser RNA translatiert wird, ebenfalls zu einem Fehler führen. Da es aber viele normale Kopien dieser RNA gibt, wird eine große Menge des normalen Proteins mit seiner normalen Funktion produziert.
  • Wie wird das Prä-mRNA-Transkript bei der mRNA-Prozessierung am 5'- und am3'-Ende modifiziert und was wird dadurch bewirkt?

    Lösung

    Am 5'-Ende wird eine Cap-Struktur in Form eines modifizierten GTP angehängt. Dies erleichtert die Bindung der mRNA an das Ribosom und schützt die mRNA vor der Hydrolyse durch Ribonucleasen. Am 3'-Ende der mRNA wird ein Poly(A)-Schwanz mit einer Länge von 100–300 Nucleotiden angehängt. Dieser unterstützt den Export der mRNA aus dem Zellkern.
  • Skizzieren Sie die Schritte des RNA-Spleißens. Welche Folgen hat es, wenn diese nicht korrekt erfolgen?

    Lösung

    snRNP-Partikel binden an eine Consensussequenz an der 5'- und 3'-Spleißstelle in der Prä-mRNA im Zellkern. Von den snRNPs vermittelt nähern sich die beiden Enden einander an. Die mRNA wird zuerst am 5'-Ende und dann am 3'-Ende geschnitten, wodurch das Intron freigesetzt wird. Die beiden Exons werden verknüpft.
  • Ein Gen mit einer Länge von 1440 bp codiert ein Polypeptid mit einer Länge von192 Aminosäuren. Wie lässt sich dieser Widerspruch erklären?

    Lösung

    Zum Codieren von von 192 Aminosäuren sind 192 Codons bzw. 576 Nucleotide erforderlich. Hinzu kommt noch ein Stoppcodon, also sind es insgesamt 579 Nucleotide. Die DNA enthält zusätzlich den Promotor und den Terminator der Transkription, zudem Introns sowie eine Sequenz für die Bindung der mRNA an das Ribosom.
  • Welche Funktionen besitzen die rRNA-Moleküle im Ribosom?

    Lösung

    Die rRNA fungiert als Gerüst für die Proteine, sodass schließlich die Ribosomenstruktur entsteht, die auch Bindungsstellen für tRNAs enthält. Eine rRNA besitzt eine Nucleotidequenz, die zu einer Region auf der mRNA komplementär ist, sodass die beiden RNAs aneinander binden können und die Translation beginnt. Eine rRNA fungiert als Katalysator für die Bildung der Peptidbindung.
  • Ausgangspunkt ist die DNA-Sequenz
    5'-ATGCCCGGGTTAAGATATTTTAAATGA-3'.
    a. Welche Sequenz hat der komplementäre DNA-Strang?
    b. Welcher Strang dient bei der Transkription als Matrize und wie ist das zu begründen?
    c. Welche Sequenzen haben die transkribierte mRNA und das translatierte Peptid?

    Lösung

    a. 3'-TACGGGCCCAATTCTTAAAATTTTACT-5'
    b. Der untere Strang wird transkribiert: Er enthält Sequenzen, die in der RNA zum Startcodon (AUG) und zum Stoppcodon (UGA) transkribiert werden.
    c. mRNA: AUGCCCGGGUUAAGAUAUUUUAAAUGA
    Polypeptid: Met-Pro-Gly-Leu-Arg-Tyr-Phe-Lys
  • Welche Struktur und welche Bedeutung hat ein Polysom?

    Lösung

    Ein Polysom entsteht, wenn gleichzeitig mehr als ein Ribosom an ein mRNA-Molekül bindet. Das ist möglich, weil sich die Ribosomen in 5'?3'-Richtung die mRNA entlangbewegen und dabei die mRNA translatieren, vergleichbar mit der Warteschlange an einer Selbstbedienungstheke. Polysomen ermöglichen die Synthese von mehr Protein innerhalb eines Zeitintervalls.
  • Wie legen Signalsequenzen den Bestimmungsort eines synthetisierten Proteins fest?

    Lösung

    Signalsequenzen werden in Proteinregionen translatiert, die an Erkennungsmoleküle und/oder Rezeptoren binden, welche für einen bestimmten Ort in der Zelle spezifisch sind.
  • Der genetische Code bestimmt die Aminosäuresequenz eines Proteins. Gibt es auch einen Code, der posttranslationale Modifikationen festlegt, etwa Phosphorylierung oder Glykosylierung? Wie könnte dieser mit dem genetischen Code zusammenhängen?

    Lösung

    Posttranslationale Modifikationen erfolgen an bestimmten Aminosäuren an bestimmten Positionen im Protein. Die Positionen werden durch die dreidimensionale Struktur des Proteins festgelegt, durch die es einem Enzym möglich ist, die Aminosäure an einer solchen Stelle zu modifizieren. Das bedeutet, dass letztendlich die Aminosäuresequenz des Proteins bestimmt, welche Aminosäure nach der Translation auf welche Weise modifiziert wird, und die Aminosäuresequenz wird wiederum durch den genetischen Code und die DNA-Sequenz des Gens festgelegt.
  • Wie unterscheiden sich Punktmutationen, die Veränderungen des Phänotyps hervorrufen, von denen, die dies nicht tun?

    Lösung

    Punktmutationen, die eine Veränderung des Phänotyps hervorrufen, können beispielsweise in dem codierten Protein zu einer veränderten Aminosäure führen, wodurch sich die Funktion des Proteins verändert. Bei einer Abwandlung des Promotors kann sich die Genexpression deutlich verändern. Wenn ein Stoppcodon entstanden ist, endet die Expression vorzeitig, und es wird ein kürzeres, möglicherweise funktionsloses Protein produziert. Punktmutationen, die phänotypisch unauffällig sind, können so in Codons auftreten, dass sich die Aminosäure aufgrund der Redundanz des genetischen Codes nicht ändert. Oder es kommt zur Veränderung eines Codons und der zugehörigen Aminosäure, ohne dass dies eine Auswirkung auf die Proteinfunktion hat. Oder die Mutationen treten in nichtcodierenden DNA-Regionen auf, etwa in Introns.
  • Wie unterscheiden sich die verschiedenen Arten von Chromosomenmutationen: Deletion, Inversion und Translokation?

    Lösung

    Deletionen sind fehlende Abschnitte von Chromosomen. Duplikationen bestehen aus einer zusätzlichen Kopie (oder mehreren Kopien) einer Chromosomenregion. Bei Inversionen liegt eine Chromosomenregion in der umgekehrten Orientierung vor. Bei Translokationen bricht ein Stück eines Chromosoms ab und heftet sich an ein anderes Chromosom.
  • Wie unterscheidet sich die spontane von der induzierten Mutagenese? Nennen Sie je ein Beispiel.

    Lösung

    Zu spontanen Mutationen kommt es ohne einen äußeren Faktor, der die Mutation verursacht. Beispiel: Die Tautomerisierung von A, sodass bei der DNA-Replikation A nicht mit T ein Basenpaar bildet, sondern mit C. Bei einer induzierten Mutation verändert ein äußerer Faktor die DNA. Beispiel: Salpetrige Säure desaminiert C zu U, sodass bei der DNA-Replikation nicht C mit G ein Basenpaar bildet, sondern U mit A.
  • Warum sind häufig G-C-Paare von Mutationen betroffen?

    Lösung

    C kann zu 5-Methylcytosin methyliert sein. Durch eine spontane Desaminierung oder durch ein Mutagen kann diese Base in ein T umgewandelt werden. Dies ist eine normale Base, die nicht durch eine DNA-Reparatur entfernt wird. Andere Basenveränderungen werden hingegen repariert.
  • Nicht alle Frauen mit einer Mutation im BRCA1-Gen erkranken an einem früh einsetzenden Brustkrebs. Warum ist das so?

    Lösung

    Eine einfache Genmutation allein reicht nicht aus, um Krebs hervorzurufen. Für die Entwicklung von Brustkrebs sind weitere genetische und äußere Faktoren erforderlich. So kann beispielsweise eine Person eine Mutation in einem anderen Gen der DNA-Reparatur tragen, das dann die Funktionen übernimmt, die mit der BRCA1-Mutation verloren gegangen waren.
  • Warum zeigen einige Familienmitglieder Symptome des Fra-X-Syndroms und andere nicht?

    Lösung

    Die Symptome treten nur dann auf, wenn von der CGC-Sequenz in der Promotorregion des FMR1-Gens zahlreiche Kopien vorhanden sind, wodurch die Expression dieses Gens verhindert wird. Familienangehörige können die Mutation tragen, zeigen aber keine Symptome, da die Mutation nur eine geringe Anzahl von Wiederholungen umfasst.
  • Die Mukoviszidose ist eine autosomal-rezessive Erkrankung, bei der in den Lungen und in den Atemwegen ein zähflüssiger Schleim produziert wird. Das Gen, das diese Krankheit hervorruft, codiert ein Protein mit 1480 Aminosäuren. Bei den meisten Patienten mit Mukoviszidose enthält dieses Protein nur 1479 Aminosäuren: An Position 508 fehlt ein Phenylalanin. Ein Neugeborenes mit Mukoviszidose hat einen älteren Bruder, der nicht davon betroffen ist. Wie würden Sie die DNA dieses Bruders untersuchen, um festzustellen, ob er ein Träger für Mukoviszidose ist?

    Lösung

    Es ist möglich, das Mukoviszidosegen direkt zu sequenzieren. Eine Person, die als Träger fungiert, ist in einem Test sowohl für das normale als auch für das mutierte Allel positiv.
  • Wie kann eine Genmutation, die eine Krankheit verursacht, kartiert und nachgewiesen werden, bevor das Proteinprodukt bekannt ist?

    Lösung

    Eine krankheitsverursachende Mutation lässt sich mithilfe einer Kopplungsanalyse kartieren. Bei vielen Patienten kann man das Auftreten der Krankheit mit einem polymorphen DNA-Marker verknüpfen, etwa einem STR. Das bedeutet, dass der Marker in der Nähe des mutierten Krankheitsgens auf dem Chromosom liegen muss. Durch DNA-Sequenzierung lässt sich das Gen identifizieren. Das von diesem Gen codierte Protein kann man dann isolieren und seine Funktion bestimmen. Der Genotyp steht immer vor dem Phänotyp.
  • Welche Vorteile bietet Screening auf Genmutationen durch Oligonucleotidhybridisierung gegenüber Tests auf phänotypische Unterschiede in der Enzymaktivität?

    Lösung

    Eine DNA-Analyse ist bei jedem Gewebe zu jedem Zeitpunkt im Lebenszyklus eines Individuums möglich. Darüber hinaus lässt sich dadurch eine etwaige Heterozygotie erkennen. Für eine Phänotypanalyse über die Enzymaktivität muss das Gen in einem zugänglichen Gewebe zu einem bestimmten Zeitpunkt exprimiert werden. Eine Heterozygotie ist auf diese Weise häufig nicht erkennbar.
  • Wie kann man die allelspezifische Oligonucleotidhybridisierung für ein Screening auf die Sichelzellanämie anwenden?

    Lösung

    Die DNA eines Patienten sollte dahingehend getestet werden, ob sie mit Sequenzen des mutierten β-Globin-Gens hybridisiert. Wenn das der Fall ist, trägt der Patient die Mutation, und eine zusätzliche Sequenzierung der DNA des Patienten ist nicht erforderlich.
  • Wie wirken Stoffwechselinhibitoren, die bei einer Chemotherapie angewendet werden, bei der Behandlung von Krebs?

    Lösung

    Stoffwechselinhibitoren blockieren wichtige chemische Umwandlungen in den Krebszellen. Ein Inhibitor kann entweder die Anhäufung eines schädlichen Produkts oder die krebsspezifische Umwandlung einer Substanz in ein schädliches Produkt verhindern.
  • Wie funktioniert eine ex vivo-Gentherapie? Können Sie ein Beispiel nennen?

    Lösung

    Bei einer in vivo-Gentherapie wird die Wildtypform eines mutierten oder anormal exprimierten Gens in die Gewebe eines Patienten eingeschleust, der an einer genetisch bedingten Krankheit leidet. Normalerweise verwendet man dafür ein Virus, und die DNA wird entweder in das Wirtschromosom integriert oder bleibt außerhalb des Zellkerns in einem Virus, das sich nicht repliziert. Ein Beispiel dafür ist das Einschleusen des Gens für die Glutamat-Decarboxylase in das Gehirn von Patienten mit dem Parkinson-Syndrom, das von einem Mangel an dem Neurotransmitter GABA hervorgerufen wird.
  • In der Vergangenheit war es üblich, dass Patienten mit einer Phenylketonurie (PKU), die ab ihrer Geburt eine Diät mit einem geringen Phenylalaningehalterhalten hatten, als Teenager zu einer normalen Ernährung zurückkehren durften. Der Phenylalaninspiegel in ihrem Blut war zwar hoch, aber man ging davon aus, dass ihr Gehirn das Stadium hinter sich gelassen hatte, in dem es davon geschädigt werden kann. Wenn eine Frau mit PKU schwanger wird, ergibt sich dabei jedoch ein Problem. Normalerweise ist der Fetus zwar heterozygot, aber in den frühen Entwicklungsphasen nicht in der Lage, die hohe Phenylalaninkonzentration durch seinen Stoffwechsel zu bewältigen, die er über das Blut der Mutter erhält.
    a. Warum ist der Fetus wahrscheinlich heterozygot?
    b.Was kann mit dem Fetus während dieser „PKU-Situation“ der Mutter geschehen?
    c. Was würden sie einer Frau mit PKU raten, die ein Kind bekommen möchte?

    Lösung

    a. Die Mutation, die zur PKU führt, kommt in der menschlichen Population selten vor, die meisten Menschen tragen das schadhafte Allel nicht. In den meisten Fällen ist der Vater homozygot normal. Da die Mutter an PKU erkrankt ist (sie ist homozygot mutiert), ist der sich entwickelnde Fetus heterozygot.
    b. Hohe Konzentrationen von Phenylalanin führen zu einer Schädigung des Gehirns. Wenn die Phenylalaninkonzentration bei der Mutter zu hoch ist, könnte das Neugeborene geschädigt werden.
    c. Die Frau sollte eine phenylalaninreduzierte Diät einhalten.
  • Eine prokaryotische Zelle kann den Zucker „X“ metabolisieren und verwendet dafür das Enzym „Xase“. Wenn X in der Umgebung nur in einer geringen Konzentration vorhanden ist, zeigt die Xase in den Zellen nur eine geringe Aktivität. Wenn jedoch die Konzentration von X hoch ist, gibt es auch viel Xase. Welche fünf Mechanismen kommen infrage, mit denen die Zelle die Aktivität der Xase verringert, wenn kein X vorhanden ist?

    Lösung

    Die Zelle kann die Transkription des Xase-Gens verringern, die Xase-mRNA hydrolysieren, die Translation der Xase-mRNA blockieren, das Xase-Protein hydrolysieren oder die Aktivität des Xase-Proteins hemmen.
  • Vergleichen Sie die molekularen Bedingungen am Promotor des lac-Operons mit und ohne Lactose.

    Lösung

    Bei Vorhandensein von Lactose ist der Promotor zugänglich, die RNA-Polymerase bindet und setzt die Transkription in Gang. Ohne Lactose ist der Promotor durch den Repressor besetzt und die Transkription bleibt aus.
  • Wie beeinflussen die σ-Faktoren und die Erkennungssequenzen die Expression von ganzen Gengruppen?

    Lösung

    σ-Faktoren lenken die RNA-Polymerase so, dass sie in bestimmten Promotoren an Erkennungssequenzen binden. Wenn mehrere Promotoren von Genen mit verwandten Funktionen (etwa bei einer Hitzschockreaktion) die gleiche Erkennungssequenz enthalten, erfolgt die Transkription dieser Gene zur selben Zeit mit der gleichen Rate.
  • Das Repressorprotein, das auf das lac-Operon von E. coli einwirkt, wird von einem regulatorischen Gen codiert. Der Repressor wird zurzeitnur in geringen Mengen und mit konstanter Geschwindigkeit produziert. Arbeitet der Promotor des Gens dieses Repressorproteinsmomentan effizient oder ineffizient? Ist die Synthese des Repressors konstitutiv oder ist er induzierbar und unterliegt Einflüssen aus der Umgebung?

    Lösung

    Damit das Repressorprotein auf niedrigem und konstantem Niveau exprimiert wird, besitzt das regulatorische Gen beispielsweise einen ineffizienten Promotor, und die Expression des Repressors ist konstitutiv.
  • Durch welche Mechanismen regulieren Transkriptionsfaktoren die Transkriptionsrate von Genen?

    Lösung

    Allgemeine Transkriptionsfaktoren binden in einem Komplex an den Promotor und die RNA-Polymerase und lenken die RNA-Polymerase an den Promotor. Dadurch wird die Transkription in Gang gesetzt und die DNA lokal denaturiert, sodass der Matrizenstrang für die Basenpaarung bei der RNA-Synthese zugänglich wird. Spezifische Transkriptionsfaktoren binden an spezifische Promotoren oder Promotoren mit Erkennungssequenzen. Andere Transkriptionsfaktoren binden an Enhancer-Sequenzen, die vom eigentlichen Promotor weit entfernt sein können und eine Biegung der DNA hervorrufen, sodass der übrige Transkriptionsinitiationskomplex rekrutiert wird.
  • Wie erkennen Transkriptionsfaktoren spezifische DNA-Sequenzen?

    Lösung

    Proteine wie beispielsweise Transkriptionsfaktoren passen aufgrund von Strukturmotiven in die DNA-Doppelhelix, und ihre Aminosäuren können mit den Basen im Inneren der Doppelhelix in Wechselwirkung treten. Die Aminosäuresequenzen der Proteine und die Basensequenzen der DNA sind spezifisch, sodass nur bestimmte Proteine an bestimmte DNA-Sequenzen binden.
  • Wie kann bei einem Eukaryoten mehr als ein Gen gleichzeitig reguliert werden?

    Lösung

    Als Reaktion auf ein Signal aus der Umgebung oder dem Inneren der Zelle wird ein spezifischer Transkriptionsfaktor erzeugt und/oder in den Zellkern transloziert, wo er an eine Erkennungssequenz in der DNA bindet, die bei Promotoren von Zielgenen liegt. Diese Bindung lenkt den Initiationskomplex der Transkription jeweils dorthin, sodass mehrere Gene aktiviert werden.
  • Beschreiben Sie die positive und die negative Regulation der viralen Genexpression bei Prokaryoten.

    Lösung

    Bakteriophage: Die Phagen-DNA wird in die Wirtszelle injiziert. Die Gene der frühen Phase werden an den Phagenpromotoren transkribiert, deren DNA-Sequenzen denen der Wirtszelle ähneln (positive Regulation). Das führt schließlich dazu, dass Proteine der frühen Phase an die Promotoren der Wirtszelle binden und diese inaktivieren (negative Regulation). Andere frühe Proteine dirigieren die RNA-Polymerase der Wirtszelle so, dass sie die Phagengene der mittleren und späten Phase transkribiert (positive Regulation).
    HIV: Die HIV-RNA wird in die Wirtszelle eingeschleust. Die Reverse Transkriptase von HIV wird aktiviert und produziert eine cDNA, die von der Integrase in ein Chromosom der Wirtszelle eingefügt wird (positive Regulation). Später bindet die RNA-Polymerase der Wirtszelle an HIV-Promotoren, sodass HIV-mRNAs erzeugt werden (positive Regulation). Das Tat-Protein von HIV fungiert als Antiterminator bei der Transkription der HIV-Gene, die in das Wirtsgenom integriert sind.
  • Wie wirkt es sich auf den Vermehrungszyklus von HIV aus, wenn die Funktion der Protease, die HIV-Proteine spaltet, durch einen Wirkstoff spezifisch blockiert wird?

    Lösung

    Bei einer HIV-Infektion sollte die Produktion und Integration der cDNA normal verlaufen. Die Virusgene werden exprimiert und das große Vorläuferprotein wird synthetisiert. Es wird jedoch nicht in die einzelnen Virusproteine geschnitten. HIV-Partikel werden also nicht verpackt und nicht aus der Zelle freigesetzt.
  • Wie beeinflussen die Modifikationen der Histone die Transkription?

    Lösung

    Histonproteine sind positiv geladen und binden an die DNA, wodurch sie die Transkription generell blockieren. Die Acetylierung der Histone neutralisiert die positive Ladung, sodass sie nicht mehr so fest an die DNA binden. So wird die Chromatinstruktur für die Transkription geöffnet. Andererseits werden bei der Deacetylierung der Histone die Acetylgruppen entfernt, sodass die positiven Ladungen auf den Histonen wieder wirksam werden und die Transkription blockiert wird.
  • Welche Befunde sprechen dafür, dass epigenetische Veränderungen das Verhalten beeinflussen?

    Lösung

    Das Verhalten in der Umgebung verändert anscheinend die DNA epigenetisch, indem die DNA-Methylierung an Promotoren von Genen im Gehirngewebe zunimmt, sodass sich die Transkriptionsrate ändert.
  • Wie kommt es zur Inaktivierung des X-Chromosoms und welche Ursache könnte das haben?

    Lösung

    Das Xist-Gen auf dem X-Chromosom wird transkribiert, wobei eine kurze RNA gebildet wird, die an das übrige X-Chromosom bindet und dadurch die Transkription der anderen Gene blockiert. Chromosomale Proteine binden an das inaktive X-Chromosom und führen zur Bildung von Heterochromatin, sodass die Genexpression blockiert ist. Man nimmt an, dass die Inaktivierung des X-Chromosoms dazu dient, die Expression von X-gekoppelten Genen bei männlichen (XY) und weiblichen Individuen (XX) auszubalancieren, da das Y-Chromosom normalerweise keine X-gekoppelten Gene enthält.
  • Bei einem kolorektalen Karzinom sind bestimmte Tumorsuppressorgene nicht aktiv, was zu einer unkontrollierten Zellteilung führt. Es gibt zwei mögliche Erklärungen für die Inaktivierung dieser Gene: a) Mutationen in codierenden Regionen, sodass inaktive Proteine erzeugt werden oder b) ein epigenetisch bedingtes Abschalten der Promotoren dieser Gene, sodass die Transkription verringert ist. Wie würden Sie versuchen herauszufinden, welcher der beiden Mechanismen zutrifft?

    Lösung

    Es ist beispielsweise möglich, die für Dickdarmkrebszellen relevanten Gene zu sequenzieren und nach Mutationen zu suchen, die zu einer fehlerhaften Funktion führen. Dann werden die beteiligten Proteine isoliert und man stellt fest, ob ihre Funktionen tatsächlich anormal sind. Um ein epigenetisches Abschalten nachzuweisen, kann man die Promotoren der Gene sequenzieren und nach epigenetischen Veränderungen suchen (beispielsweise die Methylierung von Cytosinen, die vermehrt zu erwarten ist, wenn die Transkription abgeschaltet ist). Dann sollten die Tumorzellen untersucht werden, ob die aktiven Proteine vorhanden sind, aber eben nur in geringen Mengen.
  • Wie regulieren miRNAs und siRNAs die Genexpression?

    Lösung

    miRNAs und siRNAs können über Basenpaarung mRNAs angreifen und ihre Translation verhindern, da tRNAs dann nicht binden können; oder die Inhibitor-RNAs können im Zellkern an die Prä-mRNA binden und zu deren Hydrolyse durch eine RNase führen; oder die Inhibitor-RNAs binden an die Transkriptionsstelle auf der mRNA und hindern so die RNA-Polymerase an der Transkription.
  • Wie trägt die dreidimensionale Struktur der mRNA zur Regulation ihrer eigenen Expression bei?

    Lösung

    mRNA kann sich über Wasserstoffbrücken, die zwischen komplementären Basen entstehen, auf sich selbst zurückfalten und dabei Schleifenstrukturen bilden. An diese Strukturen können spezifische Proteine binden, die dann die Translation am Ribosom blockieren.
  • Welche Funktion besitzt das Proteasom?

    Lösung

    Das Proteasom bindet an Proteine, die mit Ubiquitin für den Abbau markiert sind. Innerhalb des Proteasoms befinden sich Proteasen, die solche Proteine hydrolysieren.
  • Bevor das menschliche Genom vollständig sequenziert worden war, nahmen viele Wissenschaftler an, dass es 80.000 bis 150.000 proteincodierende Gene enthalten müsste. Tatsächlich fanden sich in der Sequenz aber dann nur etwa 21.000 Gene. Wie lässt sich dieser Widerspruch erklären?

    Lösung

    Von einem menschlichen Gen werden durch alternatives Spleißen im Durchschnitt vier verschiedene mRNAs gebildet. Jede dieser mRNAs wird in ein individuelles Protein translatiert. So ist die Anzahl der unterschiedlichen Proteine viel größer als die Anzahl der Gene.
  • Hersteller von Pharmazeutika sind daran interessiert, mRNA-Medikamente herzustellen. Wie könnten diese bei der Behandlung von Krebs wirken?

    Lösung

    miRNAs, die gegen aktivierte Onkogene gerichtet sind, blockieren die Translation der entsprechenden mRNAs, von denen sonst Proteine translatiert würden, die die Zellteilung stimulieren.
  • Warum erhält man bei der Sequenzierung von Genomen überlappende Sequenzen und wie werden sie einander zugeordnet, um schließlich die endgültige Sequenz zu bestimmen?

    Lösung

    Vor der DNA-Sequenzierung wird ein langes DNA-Molekül in viele Fragmente g. Diese Schnitte erfolgen zufällig (d.h., sie entstehen an unterschiedlichen und zufälligen Positionen). Die Überlappungen sind notwendig, um die gesamte Sequenz bestimmen zu können. Wenn es nur eine einzige Art von Schnitten gäbe, wäre ein Zusammensetzen der Sequenz nicht möglich. Der Sequenzen der Fragmente werden durch einander einen Computer mit Spezialsoftware mithilfe der Überlappungen zugeordnet.
  • Wie erkennt man in einer Genomsequenz offene Leseraster? Welche Art von Informationen lassen sich aus einem offenen Leseraster ableiten?

    Lösung

    Offene Leseraster werden durch das Vorhandensein einer Promotorsequenz, eines Start- und eines Stoppcodons, einer Transkriptionsterminationssequenz und Erkennungssequenzen für den Beginn und das Ende von Introns erkannt. Das Leseraster zeigt die Sequenz des Promotors (der das Signal vermittelt, wo das Gen exprimiert werden soll) und die Abfolge der Aminosäuren des Proteins (als Hinweis auf seine Funktion).
  • Was ist vergleichende Genomik? Nennen Sie ein Beispiel für deren Anwendung.

    Lösung

    Die vergleichende Genomik befasst sich mit der Untersuchung von DNA-Sequenzen bei verschiedenen Organismen. Ähnliche Sequenzen, die in unterschiedlichen DNA-Proben festgestellt werden, können dazu beitragen, die Funktion eines Proteins aufzuklären (wenn eine Sequenz einem bereits bekannten Protein in einem anderen Organismus ähnlich ist), die Identität einer Spezies zu ermitteln, von der nur die DNA bekannt ist (Metagenomik) und evolutionäre Beziehungen herauszufínden. Das Gen, das die relative Körpergröße von Hunden festlegt, wurde beispielsweise mithilfe der vergleichenden Genomik ermittelt.
  • Welche Gründe kann es geben, dass sich prokaryotische Genome in der Evolution so entwickelt haben, dass sie eine geringe Größe besitzen, manchmal Plasmide enthalten und Gene besitzen, die sich im Genom bewegen?

    Lösung

    Die folgenden Merkmale von prokaryotischen Genomen sind für einen Organismus essenziell. der in einer sich schnell verändernden Umgebung lebt und sich rasch anpassen muss: 1. Kleine Genome können sich durch wenige Mutationen stark verändern. 2. Plasmide ermöglichen es den einzelnen Zellen, Genominformation schnell auszutauschen. 3. Transposons verschieben Gene an andere Positionen und beeinflussen so die Expressionsrate dieser Gene, und sie verursachen Mutationen, die eine Evolution ermöglichen.
  • Wie bewegen sich Transposonsim Genom?

    Lösung

    Transposons werden entweder direkt aus dem Chromosom herausgespleißt und bewegen sich zu einer anderen Position, oder es wird eine DNA-Kopie des Transposons hergestellt, die an einer anderen Stelle eingefügt wird, wobei das ursprüngliche Transposon an seiner Stelle verbleibt.
  • Auf der Haut im Bauchnabel eines Menschen gibt es zahlreiche Bakterienspezies. Wie würden Sie mithilfe der Metagenomik einen mikrobiellen Fingerabdruck herstellen?

    Lösung

    Man könnte vom Bauchnabel einen „Fussel“ als Probe nehmen und die DNA daraus extrahieren, dann mithilfe der PCR die prokaryotischen Sequenzen amplifizieren und die Spezies identifizieren. Wenn man das bei vielen Menschen durchführt, würde man wahrscheinlich bei jedem eine spezifische Kombination von vorherrschenden Spezies finden.
  • Beschreiben Sie die Funktionen einer Gruppe von Proteinen, die man bei Caenorhabditis elegans entdeckt hat und für die es bei der Bierhefe einige wenige Gegenstücke gibt.

    Lösung

    Im Genom von C. elegans gibt es Gene für die Gewebebildung, nicht jedoch bei der Hefe.
  • Welche Bedeutung besitzen Genfamilien für die Evolution?

    Lösung

    Genfamilien liefern einen „evolutionären Baukasten“. Wenn es von einem Gen mehrere Kopien in einem Genom gibt, kann die Wildtypform des Gens Mutationen in einer Kopie dieses Gens abmildern. Wenn die Mutationen einen positiven Effekt zeigen, werden sie möglicherweise selektiert.
  • Warum befinden sich im Genom der Säuger viele Kopien von Sequenzen, die rRNAs codieren?

    Lösung

    Bei einigen Geweben, so auch in einer Eizelle, müssen (etwa nach der Befruchtung) Proteine in großer Menge synthetisiert werden, und dafür sind zahlreiche Ribosomen notwendig. Die Transkriptionsrate der einzelnen rRNA-Gene allein würde nicht ausreichen, um den Ribosomenbedarf der Zelle zu decken, sodass diese Gene in multiplen Kopien vorliegen.
  • Die Genome von Reis, Weizen und Mais sind einander ähnlich und ähneln auch dem von Arabidopsis. Durch welche Vorgänge lässt sich vielleicht erklären, warum sich diese vier Pflanzen dennoch durch jeweils nur einmal vorkommende Proteine unterscheiden?

    Lösung

    Die vier Pflanzen kommen in verschiedenen Umgebungen vor. So wächst beispielsweise Mais in trockeneren und kühleren Regionen als Reis. Mutationen im pflanzlichen Grundgenom haben es den Pflanzen mit diesen Mutationen ermöglicht, sich an die unterschiedlichen Umgebungen anzupassen, um dort zu überleben und sich zu vermehren.
  • Warum können die menschlichen Zellen eine größere Anzahl von Proteinen exprimieren als aufgrund der Anzahl proteincodierender Gene im Genom des Menschen zu erwarten ist?

    Lösung

    Jedes menschliche Gen enthält mehrere Introns. Durch alternatives Spleißen einer Prä-mRNA können unterschiedliche mRNAs und damit auch unterschiedliche Proteine entstehen.
  • Einem Patienten wird ein Medikament verschrieben, dessen Stoffwechsel bekannten Genen und Allelen unterliegt. Wie lässt sich mit einer Haplotypkartierungfeststellen, ob dieses Medikament bei dem Patienten wirksam sein wird?

    Lösung

    Die menschliche Genomsequenz enthält Haplotypen, mit denen unterschiedliche Reaktivitäten auf einen Wirkstoff zusammenhängen. Wenn man die DNA eines Patienten isoliert und amplifiziert, ist eine Charakterisierung in Bezug auf die Haplotypen möglich, und man kann feststellen, ob der Patient auf einen bestimmten Wirkstoff reagiert.
  • Wie wird das Proteom analysiert?

    Lösung

    Das Proteom wird analysiert, indem man eine große Zahl von Proteinen identifiziert, etwa mithilfe einer zweidimensionalen Gelelektrophorese und durch Identifizierung von Proteinfragmenten mithilfe der Massenspektrometrie.
  • Warum kann es sinnvoll sein, eine Datenbank für primäre und sekundäre Metaboliten zu besitzen, die im menschlichen Stoffwechsel eine Rolle spielen?

    Lösung

    Die Metabolitenmuster korrelieren mit unterschiedlichen physiologischen Zuständen. Warum es wünschenswert ist, über eine Datenbank für primäre und sekundäre Metaboliten des menschlichen Stoffwechsels zu verfügen, zeigt sich beispielsweise schon bei dem erhöhten Glucosespiegel im Blut, der mit der Krankheit Diabetes zusammenhängt. Die meisten Krankheiten sind jedoch komplexer. Diagnosen würden mit einem solchen Metabolitenmuster im Metabolom erleichtert.
  • Wie haben Cohen und Boyer die erste rekombinante DNA hergestellt?

    Lösung

    DNA von genetisch unterschiedlichen Bakterienstämmen, die jeweils ein anderes Gen für eine Antibiotikaresistenz tragen, wurde mit dem Restriktionsenzym EcoRI geschnitten und dann von der DNA-Ligase verknüpft.
  • Vergleichen Sie die die Anwendung eines GFP-Reportergens mit der Anwendung eines Gens für Antibiotikaresistenz, um Zellen zu erkennen, die eine fremde DNA-Sequenz enthalten.

    Lösung

    GFP-Reporterprotein: Alle Zellen sind lebensfähig. Antibiotikaresistenz: Die meisten Zellen sterben ab, nur die resistenten werden selektiert. GFP-Reporterprotein: Es ist nur eine UV-Lampe erforderlich, um das Produkt des Reportergens sichtbar zu machen. Antibiotikaresistenz: Das Kulturmedium muss gewechselt werden und man muss warten, bis die nichtselektierten Zellen abgestorben sind, um die Zellen mit dem Vektor erkennen zu können.
  • Stellen Sie sich vor, Sie verwenden einen Plasmidvektor, der ein Gen für Ampicillinresistenz und ein Gen für das grün fluoreszierende Protein enthält, wobei sich nur in Letzterem eine Restriktionsschnittstelle befindet. Ordnen Sie die Arbeitsschritte a–e so an, dass sie dieser Abfolge entsprechen: Ein Stück Fremd-DNA wird in das Plasmid eingefügt, das rekombinante Plasmid wird auf Bakterien übertragen und es ist festzustellen, ob das Plasmid und das fremde Gen in den Bakterien enthalten sind.
    a. Transformation von Wirtszellen
    b. Selektion von Kolonien auf Antibiotikaresistenz
    c. Selektion von Kolonien, die unter ultraviolettem Licht nicht leuchten
    d. Schneiden von Vektor-DNA und Fremd-DNA mit einem Restriktionsenzym
    e. Ligationdes geschnittenen Plasmids mit der Fremd-DNA

    Lösung

    Die Reihenfolge der Schritte ist d, e, a, b, c.
  • Welche Art von genomische Bibliothek würden Sie für folgende Zwecke verwenden?
    a. die Expression eines Gens, das in keimenden Samen eine Amylase codiert (ein Enzym, das Stärke hydrolysiert)
    b. die Sequenzierung des Amylasegens in zwei genetisch unterschiedlichen Maissorten

    Lösung

    a. Da es sich hier um eine gewebespezifische Genexpression handelt, wird mithilfe der RT-PCR eine Art Schnappschuss der mRNAs erzeugt, die zu einem bestimmten Zeitpunkt vorhanden sind, und dann identifiziert man die Amylase-mRNA.
    b. Da hier eine Genomanalyse erforderlich ist, stellt man zwei genomische DNA-Bibliotheken her und sucht darin jeweils das Amylasegen.
  • Wie lässt sich die RT-PCR anwenden, um mRNAs zu vergleichen, die in Muskel- und in Lebergewebe exprimiert werden?

    Lösung

    Die gesamte zelluläre RNA wird isoliert und man erzeugt mithilfe der Reversen Transkriptase cDNA-Kopien dieser RNAs. Die Primer für die DNA-Replikation werden für die beiden DNA-Enden des spezifischen Gens hergestellt, dessen Expression untersucht werden soll. Dann führt man mit diesen Primern die PCR durch. Das Ausmaß der Amplifikation mit diesen Primern ist proportional zur Menge der spezifischen cDNA und damit proportional zur mRNA-Menge in dem ursprünglichen Zellextrakt.
  • Beschreiben Sie eine Anwendung für synthetische DNA.

    Lösung

    Als Hybridisierungssonde zur Identifizierung eines Genotyps, etwa bei Screenings auf genetisch bedingte Krankheiten des Menschen, eignet sich synthetische DNA. Mithilfe von Mutationen, die in diese DNA eingeführt werden, lassen sich Mutationen bei Patienten nachweisen.
  • Erläutern Sie, warum sich eine cDNA-Bibliothek, die aus menschlichem Hirngewebe gewonnen wurde, wahrscheinlich von einer cDNA-Bibliothek unterscheidet, die aus Gewebe desmenschlichen Pankreas gewonnen wurde, und warum die Bibliotheken aber auch Gemeinsamkeiten aufweisen.

    Lösung

    Beide Gewebe exprimieren einige übereinstimmende Gene, die bei den zellulären Aktivitäten eine Rolle spielen, etwa beim Energiestoffwechsel (beispielsweise Gene, die Enzyme des Calvinzyklus codieren); auch für Funktionen der Informationsübermittlung (beispielsweise rRNA-Synthese) werden in beiden Geweben Gene exprimiert. Die Gewebe unterscheiden sich jedoch in Bezug auf gewebespezifische mRNAs. So produziert beispielsweise das Gehirn Proteine, die für die elektrochemische Aktivität und Kommunikation zwischen den Zellen erforderlich sind, während im Pankreas das Hormon Insulin produziert wird. Dabei ist festzuhalten, dass alle Gewebe dieselben DNA-Sequenzen besitzen – ohne Ausnahme.
  • Bei einigen Formen von Blasenkrebs ist das Gen für das Zellsignalmolekül Ras mutiert, sodass ein verändertes Protein exprimiert wird, das die Zellteilung stimuliert. Wie kann man auf Grundlage der siRNA-Technologie ein Medikament entwickeln, um die Krankheit zu behandeln?

    Lösung

    Antisense-RNA und siRNA verhindern die Translation, indem sie über Basenpaarung an die mRNA binden und so deren Abbau im Cytoplasma herbeiführen.
  • Bei der Keimung von Erbsensamen verändert sich im Embryo die Genexpression. Wie kann man dies mithilfe von DNA-Microarrays analysieren?

    Lösung

    Man lässt Erbsensamen keimen und extrahiert zu verschiedenen Zeitpunkten die RNA aus den Embryonen. Aus den mRNAs wird cDNA hergestellt und diese mit einer genomischen Bibliothek des Pflanzengenoms hybridisiert. Das Ausmaß der Hybridisierung mit diesen Genen zeigt an, welche Gene exprimiert werden.
  • Sowohl die Antisense-RNA- als auch die CRISPR-Technologie sind geeignet, die Expression spezifischer Gene zu blockieren. Welchen weiteren Nutzen hat die CRISPR-Technologie?

    Lösung

    Die CRISPR-Technologie besitzt den zusätzlichen Vorteil, dass sich damit in Genen Nucleotide spezifisch verändern lassen; so werden Mutationen oder Rückmutationen (Revertanten) erzeugt.
  • Welche grundlegenden Merkmale besitzen Expressionsvektoren?

    Lösung

    Expressionsvektoren enthalten Restriktionsschnittstellen für das Einfügen von Genen, einen Ursprung für die DNA-Replikation, einen gewebespezifischen aktiven Promotor für die gewünschten Wirtszellen und häufig eine Signalsequenz, um das Protein für die Isolierung im Labor in das extrazelluläre Medium auszuschleusen.
  • Welche Vorteile hat die Anwendung der Biotechnologie in der Pflanzenzucht?

    Lösung

    Die Biotechnologie ist schneller (im Vergleich zu einer viele Generationen dauernden Züchtung) und spezifisch (es wird nur ein Gen eingeschleust anstelle der vielen Gene, die bei der Selektion für ein komplexes Merkmal eine Rolle spielen).
  • Nach dem Experiment von Cohen und Boyer hielt eine Gruppe von Wissenschaftlern, Vertretern des öffentlichen Gesundheitswesens und Bioethikern eine Konferenz ab und einigte sich für den größten Teil der Forschung mit rekombinanter DNA auf ein vorübergehendes Moratorium. Welche Bedenken führten Ihrer Meinung nach zu diesem Moratorium? Wie wurde schließlich die Sicherheit gewährleistet, sodass das Moratorium aufgehoben wurde?

    Lösung

    Da das Bakterium E. coli normalerweise im menschlichen Darm lebt, bestand die Gefahr, dass Laborstämme, die gegen mehrere Antibiotika resistent sind, Menschen infizieren könnten. Darüber hinaus bestand die Sorge, dass die Gene der antibiotikaresistenten Stämme mit den Genen der normalen Stämme rekombinieren könnten, sodass sich mehrfach resistente Stämme entwickeln. Eine weitere Sorge bestand darin, dass Bakterien, die Gene für Toxine tragen, als biologische Waffen eingesetzt werden können. Um diesen Bedenken zu begegnen, entwickelte man die E. coli-Wirtsstämme mit einer Reihe von Mutationen, sodass sie eine spezielle Laborumgebung benötigen, um zu überleben. So hat man beispielsweise bei diesen Bakterien Mutationen in Gene für die Synthese lebensnotwendiger Metaboliten eingeführt, die im menschlichen Darm nicht verfügbar sind.
  • Welche Informationen liefern Transplantationsexerimente über den Zeitpunkt, an dem das Zellschicksal festgelegt wird, und den Einfluss der extrazellulären Umgebung auf die Determination in frühen und späten Embryonalstadien?

    Lösung

    Die Transplantationsexperimente an Amphibienembryonen zeigten, dass das Schicksal von Zellen früher Embryonalstadien noch nicht festgelegt ist und von der extrazellulären Umgebung der Zelle beeinflusst werden kann. Der Werdegang von Zellen später Embryonalstadien ist dagegen determiniert, und die Umgebung der Zelle hat keinen Effekt.
  • Wie unterscheiden sich Stammzellen aus adultem Körpergewebe von embryonalen Stammzellen?

    Lösung

    Stammzellen aus adulten Körpergeweben sind im Allgemeinen multipotent, embryonale Stammzellen in der Regel pluripotent.
  • Das Klonen erfordert eine tiefgreifende Umprogrammierung der Genexpression im Zellkern einer differenzierten Zelle, sodass sich dieser verhält, als befände er sich in einer totipotenten Zelle. Wie würden Sie diese Umprogrammierung untersuchen?

    Lösung

    Sie sollten die mRNA in Eizellen, in differenzierten Zellen der Eltern und in umprogrammierten Zellen untersuchen. Geeignete Methoden sind die RT-PCR (Reverse-Transkriptase-Polymerasekettenreaktion) oder Genexpressionsanalysen mithilfe von DNA-Microarrays.
  • Es gibt zwei Ansätze für das Klonen von Tieren. Beim therapeutischen Klonen werden Zellen eines Individuums (gentechnisch verändert oder nicht) kultiviert, sodass sie letztlich Organe bilden, die transplantiert werden können. Beim reproduktiven Klonen dient die Übertragung eines Zellkerns der Entstehung eines neuen, erwachsenen Individuums. Das Klonen zur Herstellung von neuen Individuen wurde an verschiedenen Säugetierarten bereits erfolgreich durchgeführt, sogar an Affen, doch nicht an Menschen. Nennen Sie einige Anwendungen für das Klonen von Tieren und einige mögliche Beweggründe für das Klonen von Menschenund deren Problematik.

    Lösung

    Bei Tieren kann das Klonen eingesetzt werden, um wertvolle Tiere zu vermehren und die Populationen seltener Tierarten zu vergrößern. Beim Menschen ließe sich das reproduktive Klonen von Paaren nutzen, um mit einem oder beiden Elternteilen genetische verwandte Nachkommen herzustellen, wenn einer von beiden Elternteilen keine Eizellen bzw. Spermien produzieren kann. Homosexuelle Paare könnten genetisch verwandte Kinder bekommen (wobei bei bei homosexuellen Männern natürlich eine Leihmutter das Kind austragen müsste). Paare könnten ein Kind bekommen, das genetisch identisch ist mit einem zuvor verstorbenen Kind. Das reproduktive Klonen von Menschen ist unter anderem wegen der hohen Fehlerrate, wegen noch nicht absehbarer Spätfolgen (z.B. frühes Altern) und wegen grundsätzlicher ethischer Bedenken in den meisten Ländern – so auch in Deutschland – verboten.
  • Auf welche Weise führt die cytoplasmatische Segregation in der befruchteten Eizelle zu einer Polarität und wie beeinflusst diese Polarität die Determination der Zelle?

    Lösung

    Die ungleiche Verteilung von cytoplasmatischen Komponenten in der befruchteten Eizelle kann dazu führen, dass nur eine von zwei Tochterzellen diese Komponenten nach der Zellteilung enthält. Diese Asymmetrie kann durch das Cytoskelett vermittelt werden. Sie kann dazu führen, dass nur eine der beiden Tochterzellen bestimmte Gene exprimiert, woraus sich wiederum Unterschiede in der Determination des Zellschicksals ergeben.
  • Was geschähe, wenn man zwischen der Ankerzelle und den darunterliegenden Zellen eines sich entwickelnden Fadenwurms eine synthetische impermeable Membran platzieren würde? Erläutern Sie Ihre Antwort.

    Lösung

    Die Ankerzelle könnte keine Differenzierungssignale an die darunterliegenden Zellschichten senden, sodass sich diese Zellen nicht zur Vulva entwickeln würden.
  • Molekularbiologen können Gene mit aktiven Promotoren koppeln und diese Konstrukte in Zellen einschleusen. Was würde geschehen, wenn das myoD-Gen in undifferenzierte Myoblasten eingefügt und dort überexprimiert würde? Begründen Sie Ihre Antwort.

    Lösung

    Das p21-Gen würde aktiviert und der Zellzyklus angehalten; durch die Anwesenheit anderer Transkriptionsfaktoren entstünden Muskelzellen.
  • Was sind Organidentitätsgene und wie wurden sie mithilfe von Mutationen identifiziert? Wie wirken sie hinsichtlich der Entstehung unterschiedlicher Pflanzenorgane zusammen?

    Lösung

    Organidentitätsgene spezifizieren die Blütenorgane einer Pflanze. Sie wurden identifiziert durch Funktionsverlustmutationen (die zu einem Verlust eines Organs führen) oder Funktionsgewinnmutationen. (Bei Letzteren lässt sich der Promotor eines Gens, das für die Entwicklung eines bestimmten Organs verantwortlich ist, mit einem Gen koppeln, das die Entwicklung eines anderen Organs spezifiziert, wodurch das „zweite“ Gen die Entwicklung des „ersten“ Organs vermittelt.)
    Welches Organ letztlich gebildet wird, ist nicht nur anhängig von der Expression eines einzelnen Organidentitätsgens, sondern auch davon, welche weiteren Organidentitätsgene gleichzeitig exprimiert werden. So exprimieren Wirtel, die Kronblätter bilden (Wirtel 2), und Wirtel, die Staubblätter bilden (Wirtel 3), beide Klasse-B-Gene, sind also diesbezüglich identisch. Der Unterschied zwischen den beiden Wirteln liegt in der Expression weiterer Organidentitätsgene: Bei Wirtel 2 sind es zusätzlich Klasse-A-Gene, bei Wirtel 3 Klasse-C-Gene.
  • Wenn Sie eine Rose erzeugen wollten, die nur Kronblätter besitzt, welche Art homöotischer Mutation müssten Sie im Rosengenom vornehmen?

    Lösung

    Eine Mutation, die zu einer Expression von Klasse-A- statt von Klasse-B-Genen führt, würde zur Bildung eines AB- statt eines AC-Dimers führen, sodass Kronblätter statt Staubblätter entstünden.
  • Mithilfe biotechnologischer Verfahren ist es möglich, fremde Gene, die mit einem starken Promotor gekoppelt sind und daher stark exprimiert werden, in eine Wirtszelle einzuschleusen. Was geschähe, wenn nanos in das Vorderende eines Drosophila-Embryos inseriert und dort überexprimiert würde?

    Lösung

    Alle neuronalen Vorstufen könnten eine Apoptose durchlaufen und es würden sich keine Nervenzellen ausbilden. Der Konzentrationsgradient des Hunchback-Proteins würde sich nicht korrekt ausbilden und der Embryo würde keine anterior-posteriore Achse entwickeln.
  • Inwiefern liefern die Experimente mit dem Pax6- und dem eyeless-Gen Hinweise darauf, dass Gene, die die Entwicklung steuern, hochkonserviert sind?

    Lösung

    Trotz des Austauschs der genetischen Schalter für die Augenentwicklung im Mausembryo gegen die genetischen Schalter für die Augenentwicklung des Fliegenembryos wurden bei der Maus weiterhin Augen gebildet, und umgekehrt. Das weist darauf hin, dass die genetischen Schalter im Verlauf der Evolution konserviert wurden.
  • Plasmodium vivax ist ein Protist, der eine Form der Malaria verursacht. Gelangt P. vivax in den Blutstrom, heftet sich der Erreger an ein Glykoprotein auf den roten Blutzellen. Einige Populationen des Menschen in Afrika sind immun gegen P. vivax, da ihren roten Blutzellen das Glykoprotein fehlt. In einer Reihe von Geweben wird die Transkription des Glykoproteins von einem Enhancer beeinflusst. Der Enhancer, der normalerweise in Vorstufen der roten Blutzellen synthetisiert wird, ist bei Individuen, die immun gegen diese Form der Malaria sind, mutiert. Was zeigt dieses Beispiel hinsichtlich der Evolution der Entwicklung?

    Lösung

    Die Beobachtungen untermauern die Hypothese, dass bei einigen menschlichen Populationen eine Selektion für Mutationen des Enhancers stattgefunden hat, der die Expression des Glykoproteins in Erythrocyten stimuliert. Diese genetischen Veränderungen haben menschlichen Populationen, die verstärkt von einer Infektion durch den Malariaerreger bedroht sind, zu einem Selektionsvorteil verholfen, da die Träger dieser Mutationen eine größere Immunität aufweisen als die Träger des nichtmutierten Gens.
  • Wie haben sich die verschiedenen Phänotypen bei Arthropoden durch Modifikation der Funktion bereits existierender Gene entwickelt?

    Lösung

    Das Entwicklungsgen Dll kontrolliert bei den Arthropoden die Ausbildung von Beinen. Insekten besitzen an ihren drei Thoraxsegmenten jeweils ein Beinpaar, Tausendfüßer bilden sowohl an Thorax- als auch an Abdominalsegmenten Beinpaare aus. Bei Insekten wird die Dll-Expression durch das Ubx-Protein reprimiert. Ubx wird in den Abdominalsegmenten aller Arthropoden exprimiert, besitzt in unterschiedlichen Arten jedoch unterschiedliche Funktionen. In Tausendfüßern wird es mit Dll coexprimiert und fördert die Ausbildung von Beinen. Im Verlauf der Evolution der Insekten führte eine Mutation im Ubx-Gen zu einem modifizierten Ubx-Protein, das die Dll-Expression in den Abdominalsegmenten der meisten Insekten reprimiert.
  • Inwiefern sind die Unterschiede zwischen Süß- und Salzwasserpopulationen des Stichlings ein Beispiel für eine konvergente Evolution, die durch Veränderungen der Genregulation vermittelt wird?

    Lösung

    Marine Stichlinge besitzen knöcherne Strukturen, die sie vor Fressfeinden schützen, die ebenfalls im Meer leben. Bei Süßwasserpopulationen sind diese Strukturen stark zurückgebildet bzw. fehlen ganz. Die morphologischen Unterschiede beruhen auf Unterschieden in der Expression des regulatorischen Gens Pitx1, das die Entwicklung beeinflusst und einen Transkriptionsfaktor codiert. Dieser Faktor wirdnormalerweise in den Körperregionen des sich entwickelnden Embryos gebildet, die sich zu Kopf, Rumpf, Schwanz und Becken des marinen Stichlings entwickeln. In zahlreichen Süßwasserpopulationen wird das Pitx1-Gen nicht mehr exprimiert, sodass sich der Schutzschild nicht mehr ausbildet. Dieselben Veränderungen der Genexpression haben in zahlreichen unabhängigen, voneinander isolierten Populationen stattgefunden und zu ähnlichen Phänotypen geführt – ein Beispiel für eine konvergente Evolution.
  • Warum sprechen Biologen von der „Evolutionstheorie“, obschon das Evolutionsgeschehen eine Tatsache ist?

    Lösung

    In den Naturwissenschaften ist der Begriff „Theorie“ nicht gleichbedeutend mit einer begründeten Vermutung; Letzteres wäre naturwissenschaftlich eine Hypothese. Als Theorie wird vielmehr eine Reihe eingehend überprüfter Erkenntnisse bezeichnet, mit denen sich bestimmte in der Natur beobachtete Phänomene sehr gut erklären lassen. Die Millionen von Beobachtungen, die Biologen alljährlich an lebenden und fossilen Organismen machen, zeigen, dass Evolution tatsächlich existiert. Aus den umfangreichen Fossilfunden aus aller Welt können wir ersehen, wie im Laufe der Zeit Veränderungen aufgetreten sind. Ebenso können wir an Population lebender Organismen in der Natur oder im Rahmen kontrollierter Laborexperimente beobachten, wie der Prozess der Evolution abläuft. Die Beobachtung, dass eine Evolution stattfindet, erklärt jedoch noch nicht, wie und warum sie abläuft. Der Begriff „Evolutionstheorie“ umfasst das gesamte Wissen über die Prozesse der Evolution sowie unsere Modellvorstellungen, wie diese Vorgänge ablaufen. So können Biologen beispielsweise mittels mathematischer Modelle zeigen, dass sämtliche Organismenpopulationen einer begrenzten Größe durch Gendrift evolvieren. Das bedeutet jedoch nicht, dass andere Prozesse nicht ebenfalls zu evolutionären Veränderungen führen können. Der wichtigste Beitrag von Charles Darwin zur Evolutionstheorie war seine Folgerung, dass der Prozess der natürlichen Selektion der wesentliche Faktor in der Evolution von Populationen lebender Organismen im Laufe der Zeit ist. Seit der Zeit Darwins wurde diese Idee von vielen Tausend Biologen viele Tausend Mal überprüft, und jeder von ihnen wäre durch eine klare Widerlegung der Evolutionstheorie zu bleibender Berühmtheit gelangt. Dabei hat sich aber immer wieder gezeigt, dass die natürliche Selektion für die von den Biologen an zahlreichen verschiedenen Organismen der Erde bislang beobachteten evolutionären Veränderungen von entscheidender Bedeutung war.
  • Antibiotika sind Arzneistoffe, welche die meisten Bakterien, auf die sie abzielen, abtöten. Durch genetische Mutationen können einzelne Bakterien jedoch ein kurzzeitiges Einwirken dieser Stoffe überleben. Wie wird sich Ihrer Ansicht nach im Laufe der Zeit die Häufigkeit resistenter Bakterien in Populationen ändern, die regelmäßig einem Antibiotikum ausgesetzt sind? Warum wird Ihrer Meinung nach bei Antibiotika dringend darauf hingewiesen, bei einer Behandlung die gesamte Dosis zu nehmen, statt die Einnahme einzustellen, wenn man sich wieder besser fühlt?

    Lösung

    Die meisten Bakterienindividuen sterben, wenn sie einem Antibiotikum ausgesetzt sind. Sollte es jedoch Einzelnen gelingen, eine kurzzeitige Konfrontation mit Antibiotika zu überleben, so werden sich diese nach Absetzen der Antibiotika rasch vermehren. Im Laufe der Zeit entwickelt die Bakterienpopulation auf diese Weise eine Resistenz gegen das Antibiotikum, weil alle Mutationen, die das Überleben ermöglichen, an Häufigkeit zunehmen. Bei einem vollständigen Behandlungszyklus ist davon auszugehen, dass er praktisch gegen alle Bakterien einer Population wirkungsvoll ist. Wenn keines der Bakterien einen solchen vollständigen Behandlungszyklus überlebt, kann in der Population keine Resistenz entstehen. Wird die Behandlung dagegen zu früh abgebrochen, steigt die Wahrscheinlichkeit, dass einige Bakterien (jene mit der größten Antibiotikaresistenz) überleben und sich die Bakterienpopulation erholt. Sie wird dann bei der nächsten Infektion und Behandlung eine noch höhere Resistenz gegen das Antibiotikum entwickeln.
  • Inwiefern unterscheidet sich die Auslese durch Menschen bei der Entwicklung von landwirtschaftlichen Nutzpflanzen von der natürlichen Selektion? Können Sie ein Beispiel für ein Merkmal nennen, das man durch künstliche Auslese in der Landwirtschaft begünstigen würde, während es in einer Wildpopulation durch natürliche Selektion ausselektiert wird?

    Lösung

    Der Mensch selektiert Merkmale bei Populationen von Kulturpflanzen und domestizierten Tieren danach, wie interessant diese für ihn sind, und nicht danach, wie diese sich auf die natürliche Fortpflanzungsrate oder Überlebenswahrscheinlichkeit der Organismen auswirken. Viele dieser vom Menschen selektierten Merkmale wären in natürlichen Populationen nicht von Vorteil. So hat der Mensch beispielsweise zahlreiche Rinderrassen auf hohes Körpergewicht und einen hohen Körperfettanteil selektiert. Dadurch bekommen diese Rassen besonders große Kälber, was häufig zu Problemen bei der Geburt führt. Vielfach müssen die Viehzüchter Geburtshilfe leisten, weil das Kalb (und vermutlich auch seine Mutter) ohne eine solche Unterstützung die Geburt nicht überleben würden. In Populationen in der Natur würde die Selektion zu kleineren Kälbern mit einem geringeren Geburtsgewicht führen, denn dadurch würden die Chancen auf eine erfolgreiche Fortpflanzung und das Überleben der Tiere steigen.
  • Die natürliche Selektion kann Populationen nicht an Bedingungen anpassen, die sie noch nicht erfahren haben. Viele Organismen scheinen jedoch auf natürliche Ereignisse zu reagieren, bevor diese eintreten. Beispielsweise begeben sich zahlreiche Säugetiere in den Winterschlaf, solange es noch recht warm ist. Ähnlich ziehen viele Vögel aus der gemäßigten Zone schon lange vor Beginn des Winters in ihre Überwinterungsgebiete im Süden. Wie haben sich Ihrer Ansicht nach solche „vorausschauenden“ Verhaltensweisen entwickelt?

    Lösung

    Durch entsprechende Verhaltensweisen können Organismen auf Anzeichen in der Umwelt reagieren, die auf künftig eintretende Bedingungen hindeuten. Sofern dieses Verhalten genetisch gesteuert ist, kann die Selektion darauf einwirken. Beispielsweise verkürzt sich die Tageslänge, je näher der Winter rückt. Daher haben Säugetierindividuen einen Überlebensvorteil, wenn sie auf die verkürzten Tage reagieren und sich in den Winterschlaf begeben. In diesem Fall deuten die Anzeichen in der Umwelt (die Tageslänge) auf die künftig eintretenden Bedingungen (die Kälte des Winters) hin. Die Eigenschaft des Winterschlafs existiert heute, weil diese Zusammenhänge (Verkürzung der Tageslänge mit nahendem Winter) schon seit langer Zeit bestehen.
  • Immer mehr Menschen werden immer älter. Daher werden viele von ihnen mit degenerativen Krankheiten wie Alzheimer konfrontiert, die (in den meisten Fällen) mit fortschreitendem Alter verknüpft sind. Angenommen, manche Individuen besäßen eine genetische Prädisposition, die diese Krankheiten erfolgreich verhindert. Ist es wahrscheinlich, dass die natürliche Selektion alleine eine solche Prädisposition in der menschlichen Bevölkerung begünstigen würde? Warum oder warum nicht?

    Lösung

    Die natürliche Selektion kann nicht einwirken, wenn sich keine Auswirkung auf die Reproduktionsrate des Organismus ergibt. Krankheiten wie Alzheimer treten in der Regel erst lange nach der reproduktiven Altersphase auf. Da sich die Krankheit nicht auf die Überlebenswahrscheinlichkeit des Nachwuchses der betroffenen Personen auswirkt (etwa durch verringerte elterliche Fürsorge), ist nicht zu erwarten, dass die natürliche Selektion einen Rückgang der Alzheimer-Krankheit in der menschlichen Bevölkerung bewirkt.
  • Inwiefern sind Mutationen ein notwendiger Bestandteil des Evolutionsprozesses?

    Lösung

    Mutationen sorgen für die genetische Variabilität, auf die alle anderen Evolutionsprozesse einwirken.
  • Welche Form von Merkmalen wird eher durch Gendrift als durch natürliche Selektion evolvieren?

    Lösung

    Neutrale Merkmale (also solche, die sich weder vorteilhaft noch nachteilig auswirken) können alleine durch genetische Drift in einer Population zu- oder abnehmen. In kleinen Populationen spielen zufällige Effekte eine große Rolle. Sofern eine Population nur wenige Individuen umfasst, die sich bezüglich ihrer biologischen Fitness nur relativ geringfügig unterscheiden, werden sich Faktoren, die nicht direkt mit der Fitness der Organismen korreliert sind, wahrscheinlich darauf auswirken, welche Individuen überleben und sich fortpflanzen. Unter diesen Bedingungen können sogar leicht nachteilige Merkmale in relativ kurzer Zeit in der Population fixiert werden.
  • Beschreiben Sie, unter welchen Bedingungen nichtzufällige Paarungen zu Evolution führen und unter welchen nicht.

    Lösung

    Selbstbefruchtung verringert die Häufigkeit von Heterozygoten, verändert aber nicht die Allelfrequenzen in einer Population. Im Gegensatz dazu führt die sexuelle Selektion (also nichtzufällige Paarungen, bei denen bestimmte Phänotypen bevorzugt werden) zu einer gerichteten Veränderung in der Population und diese evolviert.
  • Unter welchen Voraussetzungen könnte Ihrer Ansicht nach Genfluss die Evolution einer Population verlangsamen.

    Lösung

    Eine kleine Population könnte einer starken Selektion für ein bestimmtes Merkmal unterliegen, das lokal von Vorteil ist. Sofern ein umfangreicher Genfluss von benachbarten Populationen erfolgt, in denen dieses Merkmal nicht begünstigt ist, könnte dies dazu führen, dass sich der Genfluss aus den umliegenden Populationen stärker bemerkbar macht als die Selektion für das betreffende Merkmal.
  • Im Folgenden sind die Genotypen an LocusA für zehn Individuen einer diploiden Population aufgelistet: AA, AA, Aa, Aa, Aa, Aa, aa, aa, aa, aa.
    a. Wie hoch ist dieser Auflistung zufolge die beobachtete Frequenz des Allels aund wie hoch die des Allels A?
    b. Wie hoch sind die beobachteten Frequenzen der Genotypen aa, Aa und AA?
    c. Wie sähen nach den Erwartungen des Hardy-Weinberg-Gleichgewichts die Frequenzen der Genotypen aa, Aa und AA nach einer Generation zufälliger Paarungen aus?

    Lösung

    a. Frequenz von Allel a: 0,60; von Allel A: 0,40
    b. Frequenz von Genotyp aa: 0,40; von Genotyp Aa: 0,40; von Genotyp AA: 0,20
    c. erwartete Frequenz von Genotyp aa: 0,36; von Genotyp Aa: 0,48; von Genotyp AA: 0,16
  • In einer Krötenpopulation liegt Allel A mit einer Frequenz von 0,2 vor, Allel a mit einer Frequenz von 0,8. Welche Frequenz ist nach dem Hardy-Weinberg-Gesetz für den Genotyp Aa in der Population zu erwarten?

    Lösung

    2pq = 2(0,2)(0,8) = 0,32
    Da die beobachtete Frequenz der Heterozygoten geringer ist als die nach dem Hardy-Weinberg-Gesetz zu erwartende, lässt sich dieses Muster durch alle folgenden Erklärungen logisch begründen:
    Kröten aus zwei oder mehr benachbarten Teilpopulationen könnten sich im gleichen Teich fortpflanzen. Die Allelfrequenzen könnten in jeder der Populationen unterschiedlich sein und in jeder der Teilpopulationen zu hohen Frequenzen unterschiedlicher Allele führen. Mit anderen Worten: Die Annahme, dass kein Genfluss erfolgt, trifft nicht zu.
    Die Kröten könnten sich innerhalb der Population nicht nach dem Zufallsprinzip paaren. Würden sich beispielsweise nahe verwandte Kröten eher miteinander paaren als entfernt verwandte, so wären in der Population weniger Heterozygote zu erwarten (eine Form von Inzucht).
    Heterozygote Individuen könnten in der Population im Nachteil sein (indem z.B. weniger Heterozygote bis zum Adultstadium überleben). Dadurch würde die für das Hardy-Weinberg-Gleichgewicht getroffene Annahme verletzt, dass keine Selektion erfolgt.
  • Angenommen, die beobachtete Frequenz des Genotyps Aa in der Krötenpopulation von der vorangegangen Aufgabe läge statt bei der von Ihnen aufgrund der Berechnung erwarteten Frequenz bei 0,15. Welche Erklärungsmöglichkeiten gäbe es hierfür?

    Lösung

    Vermutlich ist die beobachtete Population groß genug, um zu berechnen, dass die geringe Frequenz der Heterozygoten signifikant ist. Sofern die gegenwärtige Krötengeneration allerdings aus einer kleinen Zahl von Elterntieren der vorherigen Generation hervorgegangen ist, könnten die zufälligen Effekte einer kleinen Populationsgröße das beobachtete Muster erklären.
  • Beschreiben Sie die verschiedenen zu erwartenden Ergebnisse von stabilisierender, gerichteter und disruptiver Selektion.

    Lösung

    Durch eine stabilisierende Selektion verringert sich die Variabilität innerhalb der Population und der unimodale (eingipflige) Phänotyp nimmt an Häufigkeit zu. Bei der gerichteten Selektion verändert sich der unimodale Phänotyp der Population in eine Richtung. Eine disruptive Selektion führt zu einer bimodalen (zweigipfligen) Verteilung der Phänotypen in einer Population.
  • Warum ist Ihrer Meinung nach zu erwarten, dass die Selektion auf das menschliche Geburtsgewicht eher stabilisierend als gerichtet wirkt?

    Lösung

    Die die Sterblichkeit nimmt sowohl bei geringerem als auch bei höherem Geburtsgewicht im Vergleich zu dem optimalen Gewicht von etwa 3400 g jeweils zu. Deutlich kleinere Babys sind eher Frühgeburten oder mangelernährt und haben daher geringere Überlebenschancen. Bei erheblich größeren Babys kann es zu Komplikationen unter der Geburt kommen, wodurch das Baby wie auch die Mutter während der Geburt einem größeren Risiko und vermehrtem Stress ausgesetzt sind. Daher überleben Babys, deren Gewicht nahe dem mittleren Geburtsgewicht der Bevölkerung liegt, am ehesten und wachsen bis zum Erwachsenenalter heran. Dadurch erhöht sich zugleich die relative Frequenz von Allelen für eine mittlere Größe bei der Geburt in der Population.
  • Nennen Sie mögliche Beispiele für extreme Phänotypen in einer Tier- oder Pflanzenpopulation, die man durch gerichtete Selektion erklären könnte.

    Lösung

    Wahrscheinlich ist fast jeder Phänotyp eines Organismus, der deutlich von dem seiner nahen Verwandten abweicht, das Resultat einer gerichteten Selektion. Von den vielen Tausend möglichen Beispielen denken Sie etwa an den langen Hals von Giraffen, den langen Rüssel und großen Ohren von Elefanten, die außergewöhnliche Körpergröße von Walen, das große Gehirn des Menschen, die enorme Größe von Riesenmammutbäumen und die großen Schwimmblätter von Seerosen. Selbstverständlich kann gerichtete Selektion ebenso zur Verringerung der Größe führen, wie bei der geringen Körpergröße der Kolibris im Vergleich zu anderen Vögeln oder bei der winzigen Blattgröße von Wasserlinsen verglichen mit anderen Blütenpflanzen. Mit Sicherheit werden Ihnen noch viele weitere Beispiele dazu einfallen.
  • Auf welche Weise kann das Vorhandensein einer großen genetischen Variabilität innerhalb einer Population die Chancen erhöhen, dass einige Mitglieder der Population eine Umweltveränderung bislang unbekannten Ausmaßes überleben? Warum gibt es keine Garantie, dass dies der Fall wäre?

    Lösung

    Eine hohe genetische Variabilität erhöht die Möglichkeiten, dass vorteilhafte Allele oder Merkmale vorhanden sind. Wenn bei einer plötzlichen Veränderung der Umwelt in der Population bereits dafür geeignete Merkmale vorliegen, kann die Selektion dafür sorgen, dass diese häufiger werden, und die Population kann rasch evolvieren. Allerdings ist eine hohe genetische Variabilität keine Garantie dafür, dass in der Population tatsächlich schon geeignete vorteilhafte Allele vorkommen.
  • Die größten rezenten Imagines (Adultformen) von Insekten wiegen weniger als 75 g (und damit weniger als ein relativ kleiner Singvogel wie ein Star). Da viele flugfähige Vögel weitaus größer sind als sämtliche Insekten, kann das Flugvermögen die gegenwärtige Größe von Insekten nicht alleine einschränken. Formulieren Sie eine Hypothese dafür, warum heute keine Rieseninsekten die Erde bevölkern.

    Lösung

    Insekten könnten durch ihr Atmungssystem (Tracheen) physiologisch eingeschränkt sein. Wahrscheinlich ist dieses nicht ausreichend für einen Körper der Größe von Vögeln. Eine weitere Einschränkung könnte das Gewicht des Exoskeletts im Verhältnis zu den dünnen Beinen sein, das bei zunehmender Körpergröße zu einem immer ausgeprägteren Missverhältnis führt. Die begrenzte Körpergröße bei Insekten ist ein Beispiel für eine Einschränkung durch die stammesgeschichtliche Vergangenheit bzw. Herkunft.
  • Die natürliche Selektion führt zu allmählichen Veränderungen innerhalb von Arten über lange Zeiträume hinweg. Beschreiben Sie ein Ereignis, das bei vielen Arten gleichzeitig signifikante und plötzliche Veränderungen zur Folge haben könnte.

    Lösung

    Alles, was zu einer plötzlichen Veränderung der Umwelt in weiten Gebieten führt, würde sich wahrscheinlich auf viele Arten gleichzeitig auswirken. Beispiele hierfür sind der Einschlag eines sehr großen Meteoriten oder Kometen, eine sehr ausgedehnte Vulkanaktivität, ein plötzlicher starker Klimawandel oder eine dauerhafte Überflutung.
  • Welche biologischen Vorgänge sind in einem Stammbaum repräsentiert?

    Lösung

    Evolutionäre Stammbäume können sämtliche Prozesse repräsentieren, durch die sich Entwicklungslinien von Organismen aufspalten, wie Artbildung (in diesem Fall stellt der Baum die evolutionären Verwandtschaftsbeziehungen zwischen Arten dar), die Replikation von Viren (hierbei werden die entwicklungsgeschichtlichen Beziehungen zwischen verschiedenen Virenlinien dargestellt) oder Genduplikation (dabei bezieht sich die Darstellung des Stammbaums auf die Beziehungen zwischen Genen). In diesem Lehrbuch sind durch die evolutionären Stammbäume überwiegend evolutionäre Beziehungen zwischen Arten oder höheren Taxa von Organismen veranschaulicht.
  • Warum ist es wichtig, beim Erstellen eines Stammbaums ausschließlich homologe Merkmale zu berücksichtigen?

    Lösung

    Weil die Ähnlichkeiten bei homologen Merkmalen auf ihre gemeinsamen Abstammung zurückgehen. Auf konvergenter Evolution beruhende Ähnlichkeiten (beispielsweise die Flügel von Vögeln und Insekten) können bezüglich der evolutionären Beziehungen in die Irre führen, wenn sie fälschlicherweise als homologe Merkmale angesehen werden.
  • Nennen Sie einige der Gründe dafür, warum bei nur entfernt miteinander verwandten Arten ähnliche Merkmale entstehen können. Fallen Ihnen dazu Beispiele vertrauter Organismen ein? Wie erklären Biologen diese Konvergenzen bzw. Analogien bei der Rekonstruktion von Stammbäumen?

    Lösung

    Die Selektion zur Anpassung an ähnliche Umweltbedingungen führt häufig zur konvergenten Evolution bestimmter Merkmale. Beispielsweise besitzen sowohl Fische als auch Delfine Flossen und weisen eine ähnliche Körperform auf, weil in einer aquatischen Umgebung bei schnellen Schwimmern eine starke Selektion für diese Merkmale erfolgt. Diese haben sich jedoch in den beiden Gruppen unabhängig voneinander entwickelt. Solche Konvergenzen können Biologen in der Regel aufdecken, weil sie im Widerspruch zu einer großen Zahl homologer Merkmale in den Gruppen stehen, deren Ähnlichkeit auf einer gemeinsamen Abstammung in jüngerer Zeit beruht. Durch Anwendung des Parsimonieprinzips können Biologen die Zahl der Konvergenzen minimieren.
  • Warum legen verschiedene Biologen bei der Formulierung von Artkonzepten ihren Schwerpunkt auf unterschiedliche Eigenschaften von Arten?

    Lösung

    Biologen sind an vielen Aspekten von Arten interessiert. Welchen Schwerpunkt sie legen, hängt davon ab, welche Fragen sie zu den betreffenden Spezies beantworten möchten. Haben sie das Ziel herauszufinden, welche Prozesse zur Aufspaltung von Abstammungslinien führten, so befassen sie sich vorwiegend mit den Mechanismen, die es den Linien ermöglichen, sich auseinanderzuentwickeln und nach der Divergenz voneinander isoliert zu bleiben (also damit, wie Arten überhaupt entstehen und voneinander getrennt bleiben). Geht es Biologen hingegen hauptsächlich darum, Arten zu identifizieren und ihre räumliche und zeitliche Verbreitung zu verstehen, dann werden sie ihr Augenmerk vor allem auf stammesgeschichtliche Aspekte legen oder darauf, wie man Arten am besten auseinanderhalten kann (d.h., wie man Arten in der Natur erkennt). Wieder andere Biologen sind vielleicht in erster Linie daran interessiert, wie Arten in Lebensgemeinschaften in Coexistenz leben. Sie werden eher die ökologische Rolle von Arten in den Mittelpunkt stellen (also wie sich diese in ihren Anpassungen und ökologischen Nischen unterscheiden). Abhängig von diesen Schwerpunkten sind für die Biologen unterschiedliche Eigenschaften von Arten von Bedeutung.
  • Was macht die reproduktive Isolation zu einem so wesentlichen Bestandteil all der hier vorgestellten Artkonzepte?

    Lösung

    Linien von Organismen, die sich geschlechtlich fortpflanzen, müssen in erheblichem Umfang reproduktiv isoliert sein, nur dann können sie voneinander getrennt bleiben. Selbst wenn ein Biologe also überwiegend das morphologische Artkonzept anwendet, so ist dabei zu beachten, dass die morphologischen Unterschiede zwischen Arten in Zeit und Raum nicht aufrechterhalten bleiben können, solange nicht eine weitgehende reproduktive Isolation zwischen den beiden Spezies besteht. Somit ist die reproduktive Isolation für das morphologische Artkonzept von zentraler Bedeutung. Den vielen Versionen des phylogenetischen Artkonzepts zufolge sind Arten eigenständige Zweige am Stammbaum des Lebens. Damit diese Zweige über die Zeit hinweg voneinander getrennt bleiben, muss zwischen ihnen eine erhebliche reproduktive Isolation bestehen. Die reproduktive Isolation spielt also – ob direkt oder indirekt – für all die verschiedenen Artkonzepte eine wichtige Rolle.
  • Warum lässt sich das biologische Artkonzept nicht auf Organismen mit ungeschlechtlicher Fortpflanzung anwenden? Lässt es sich daher Ihrer Meinung nach nur eingeschränkt verwenden?

    Lösung

    Das biologische Artkonzept ist lediglich anwendbar auf „natürliche Populationen, die sich tatsächlich oder potenziell untereinander kreuzen können“. Organismen mit ungeschlechtlicher Fortpflanzung bilden eindeutig keine solchen Populationen. Dennoch bilden auch sie Abstammungslinien, die in Raum und Zeit existieren und durch andere Faktoren aufrechterhalten bleiben, etwa durch die verfügbaren ökologischen Nischen. Die meisten Biologen, die das biologische Artkonzept anwenden, interessieren sich überwiegend dafür, welche Mechanismen mit der Zeit zur reproduktiven Isolation geführt und dafür gesorgt haben, dass diese bestehen blieb. Die phylogenetischen Artkonzepte stehen nicht im Widerspruch zum biologischen Artkonzept, beziehen sich aber auf sämtliche Arten, ungeachtet ihrer Form der Fortpflanzung. Überdies ermöglichen es die phylogenetischen Artkonzepte Biologen, Arten auch über geologische Zeiträume hinweg zu erforschen (in denen keine mit der Fortpflanzung einhergehenden Interaktionen möglich sind).
  • Dem Dobzhansky-Muller-Modell zufolge führt eine Divergenz zwischen Allelen an unterschiedlichen Genorten zu einer genetischen Inkompatibilität von Arten. Warum gilt eine genetische Inkompatibilität zwischen zwei Allelen am gleichenGenort als weniger wahrscheinlich?

    Lösung

    Wenn sich divergierende Linien lediglich an einem einzigen Genort unterscheiden, müssen die beiden neuen Allele funktionsfähig sein, wenn sie mit den Produkten anderer Genorte in Wechselwirkung treten (in beiden Linien). Jegliche durch diese neuen Allele entstehende genetische Inkompatibilität würde sich wahrscheinlich auch auf die Elternlinien auswirken. Bei verschiedenen Genorten ist eine viel größere Zahl potenzieller Inkompatibilitäten möglich. Statt zwei nachteiligen Änderungen am selben Genort (jeweils eine in jeder Linie) berücksichtigt das Dobzhansky-Muller-Modell neutrale Änderungen an jeglichen Genortpaaren, deren Produkte miteinander interagieren. Es sind die negativen Wechselwirkungen dieser Produkte bei den Hybriden der beiden Linien, die zur genetischen Inkompatibilität führen.
  • Nehmen Sie an, die reproduktive Isolation, wie Sie sie bei den Phlox-Sorten gesehen haben, resultiere aus letalen Kombinationen inkompatibler Allele an mehreren Genorten bei den verschiedenen Sorten. Warum könnte die zwischen diesen Sorten beobachtete reproduktive Isolation ausgehend von dieser Annahme nur partiell statt vollständig sein?

    Lösung

    Recht wahrscheinlich ist die Möglichkeit, dass die inkompatiblen Allele bei den verschiedenen Sorten noch nicht fixiert wurden. Daher resultieren nur einige der möglichen Kombinationen von Kreuzungen in genetischer Inkompatibilität.
  • Erläutern Sie, wie es innerhalb von nur zwei Generationen zur Artbildung durch Polyploidie kommen kann.

    Lösung

    Polyploide (z.B. Tetraploide) können bereits in der ersten Generation entstehen. In der zweiten Generation können dann Diploide und Tetraploide hybridisieren und triploide Individuen bilden. Bei den Triploiden entstehen in der Meiose jedoch Gameten mit ungleicher Chromosomenzahl, was zu unfruchtbaren Nachkommen führt. Wenn sich ein tetraploides Individuum der F1-Generation selbst befruchtet oder mit einem anderen tetraploiden Individuum kreuzt, können daraus fruchtbare Nachkommen hervorgehen. Somit sind die polyploiden Individuen von der diploiden Art reproduktiv isoliert und bilden eine eigenständige Spezies.
  • Allopatrische Artbildung ist bekanntlich die vorherrschende Form der Speziation. Welche Vorhersage können Sie angesichts dieser Tatsache über die geographische Verbreitung zahlreicher nahe verwandter Arten treffen? Weicht Ihre Antwort für sesshafte Arten von der für sehr mobile ab?

    Lösung

    Allopatrisch entstehende Arten kommen zu Beginn in getrennten, aber gewöhnlich benachbarten Verbreitungsgebieten vor (beispielsweise ?Abb.22.6). Daher ist zu erwarten, dass viele nahe verwandte Arten diesem Muster folgen. Weil sich die Verbreitungsgebiete von sehr mobilen Arten im Laufe der Zeit eher ändern werden, sollte dieses Muster bei eher sesshaften Arten am stärksten ausgeprägt sein. Biologen konnten diese Hypothese bei vielen unterschiedlichen Organismengruppen bestätigen.
  • Auf welche Weise können die Spezialisierung von Bestäubern bei Pflanzen und die sexuelle Selektion bei Tieren die Artbildungsraten erhöhen?

    Lösung

    Wenn sich ein Bestäuber auf einen bestimmten Blütentyp spezialisiert, verringert dies die Gelegenheiten für eine Fremdbefruchtung von unterschiedlichen Blütentypen. Ein Polymorphismus der Blüten kann somit zu einer raschen genetischen Divergenz der Individuen führen, bei denen der jeweilige Blütentyp exprimiert ist. Ein ähnlicher Prozess läuft im Rahmen der sexuellen Selektion bei Tieren ab. Paaren sich manche Weibchen bevorzugt mit Männchen, die ein bestimmtes Merkmal aufweisen, während andere ein anderes Merkmal der Männchen bevorzugen, dann kann dies rasch eine genetische Isolation und Differenzierung der beiden Gruppen nach sich ziehen.
  • Warum kommt es häufig dann zu einer adaptiven Radiation, wenn eine Gründerart ein isoliertes geographisches Gebiet besiedelt?

    Lösung

    Wenn eine Art ein isoliertes Gebiet neu besiedelt, dann trifft sie dort möglicherweise auf keine Konkurrenz bezüglich einer bestimmten Ernährungs- oder Lebensweise. Unter solchen Bedingungen gibt es zahlreiche „freie Nischen“, welche die neuen Besiedler einnehmen können, weshalb die Artbildungsrate rasch zunimmt.
  • Warum ist die Fixierungsrate neutraler Mutationen unabhängig von der Populationsgröße?

    Lösung

    Wenn man lediglich die Nucleotidunterschiede zählt, werden multiple Substitutionen nicht erfasst, darunter gleichzeitige Substitutionen, parallele Substitutionen und Rücksubstitutionen. Mithilfe von Evolutionsmodellen lässt sich die Zahl der erfolgten multiplen Substitutionen abschätzen, aufbauend auf der Anzahl der tatsächlich beobachteten Unterschiede. Beispielsweise zeigt das zweite Nucleotid der Sequenzen a und b in Aufgabe 1 nur einen einzigen Unterschied zwischen A und T. Dieser Unterschied ließe sich zwar durch einen einzelnen Austausch von T durch A in Sequenz a erklären, genauso gut könnten aber auch zwei Substitutionen stattgefunden haben (z.B. eine erste von T durch C und dann eine weitere von C durch A). Solche multiplen Substitutionen werden mit einer einfachen Zählung der Unterschiede nicht erfasst.
  • Nennen Sie einige potenzielle Vorteile eines horizontalen Gentransfers für den Organismus, der durch diesen Mechanismus neue Gene erhält.

    Lösung

    Durch neue Gene können auch neue Funktionen hinzukommen. So würde beispielsweise der horizontale Transfer eines Gens, das eine Antibiotikaresistenz vermittelt, Bakterien, die Antibiotika ausgesetzt sind, einen enormen Vorteil verschaffen.
  • Warum wird Genduplikationen für evolutionäre Veränderungen über einen längeren Zeitraum eine große Bedeutung zugemessen?

    Lösung

    Genduplikationen bilden das Ausgangsmaterial für einen Großteil der Evolution. Ein dupliziertes Gen kann ungeachtet seiner ursprünglichen Funktion ungehindert divergieren, weil die Originalkopie des Gens weiterhin ihre eigentliche Funktion erfüllen kann.
  • Wie kann man anhand der Evolution von Genen die Proteinfunktion erforschen? Beschreiben Sie ein spezifisches Beispiel dafür.

    Lösung

    Durch Vergleiche der evolutionären Veränderungen von Proteinen bei verschiedenen Arten, bei denen diese Proteine unterschiedliche Funktionen erfüllen, lassen sich Einblicke gewinnen, welcher Zusammenhang zwischen Veränderungen der Sequenz und der Funktion von Proteinen besteht. So zeigen beispielsweise Veränderungen bei vielen unterschiedlichen Genen zahlreicher verschiedener Arten von Kugelfischen, welche dieser Veränderungen mit der Evolution der Tetrodotoxinresistenz bei den Genen für Natriumkanäle korreliert sind. Solche Untersuchungen tragen zu einem besseren Verständnis der Funktion von Natriumkanälen bei. Dies hilft Wissenschaftlern wiederum, die genetischen Grundlagen verschiedener neurologischer Erkrankungen besser zu verstehen.
  • Welches sind die entscheidenden Elemente einer in vitro-Evolution und inwiefern entsprechen diese Elemente natürlichen Evolutionsprozessen?

    Lösung

    Die in vitro-Evolution geht von einem umfangreichen Pool von zufällig ausgewählten Sequenzen aus und umfasst mehrere Durchläufe der Selektion und Mutation. Dadurch entstehen neue Moleküle mit bestimmten Funktionen. Dieser Ablauf entspricht genau den Prozessen von Mutation und natürlicher Selektion in Populationen in der Natur – mit einem einzigen Unterschied: Die Selektions- und Mutationsvorgänge werden im Labor von Menschen kontrolliert, um Moleküle mit erwünschter Funktion herstellen zu können.
  • Wie kann man unter Anwendung der Prinzipien der Evolutionsbiologie neu aufkommende Krankheiten erkennen?

    Lösung

    Die meisten neu aufkommenden Krankheiten werden durch lebende, evolvierende Organismen verursacht. Evolutionäre Vergleiche der DNA-Sequenzen dieser Pathogene ermöglichen es, die Ursachen von Krankheiten rasch erkennen und eliminieren zu können (etwa aus einer bestimmten Wirtsart oder in einem bestimmten geographischen Gebiet). Bislang noch nicht identifizierte Krankheitserreger kann man mit ihren nächsten Verwandten vergleichen. Daraus können Biologen vielfach Vorhersagen treffen, mit welchen Maßnahmen sich die Ausbreitung der Krankheiten am besten unter Kontrolle bekommen lässt.
  • Geben Sie eine Erklärung dafür, warum ein gelegentlicher Schneesturm im Winter für Diskussionen zur globalen Klimaerwärmung nicht relevant ist.

    Lösung

    Unter Klima versteht man die durchschnittlich erwarteten Wetterverhältnisse an einem bestimmten Ort über einen längeren Zeitraum, unter Wetter die täglich stattfindenden Ereignisse. Selbst wenn die langfristigen Klimaprognosen eine allmähliche Erwärmung erwarten lassen, wird es wahrscheinlich dennoch an bestimmten Orten weit weg von den Tropen gelegentlich im Winter Schneestürme geben. Eine langfristige Zunahme der Durchschnittstemperatur von 1 °C stellt eine erhebliche Klimaänderung dar, an einem bestimmten Ort sind aber dennoch im Laufe eines Jahres umfangreiche Temperaturschwankungen zu erwarten.
  • Führen Sie aus, welche Umweltveränderungen gegen Ende des Präkambriums die Evolution von Gruppen vielzelliger Organismen begünstigt haben könnten.

    Lösung

    Gegen Ende des Präkambriums kam es zu mehreren gravierenden Veränderungen der Umwelt. Damals endete die Periode der „Schneeballerde", in der das Leben weitgehend auf einige wenige relativ warme Gebiete wie heiße Quellen und hydrothermale Tiefseequellen beschränkt war. Die Erwärmung der Erde zog eine rasche Diversifizierung des Lebens nach sich. Zudem reicherte sich in der Atmosphäre rasch Sauerstoff an. Vielzellige Organismen haben für ihren Stoffwechsel höhere Anforderungen als einzellige. Als sich infolge der ersten photosynthetisch aktiven Organismen Sauerstoff in der Erdatmosphäre anzureichern begann, erwies sich dieser für die damals auf der frühen Erde lebenden einzelligen, anaeroben Organismen als toxisch. Einige Linien entwickelten sich dahingehend, dass sie den Sauerstoff zunächst tolerieren und dann sogar zur aeroben Atmung nutzen konnten. Das ermöglichte die Evolution großer Organismenkolonien. Eine immer engere Kooperation unter den einzelnen Individuen koloniebildender Formen verbunden mit Arbeitsteilung führte schließlich zur Evolution echter vielzelliger Organismen (aus mehreren bis vielen unterschiedlichen Zelltypen bestehende Individuen).
  • Nennen Sie eine wahrscheinliche Ursache für die Grüne Revolution im Känozoikum und erläutern Sie, warum diese die Radiation der Blütenpflanzen (Angiospermen) ermöglichte.

    Lösung

    Ein bedeutender Faktor war die Evolution von zwei Genen bei Leguminosen. Sie ermöglichten es diesen Pflanzen, den atmosphärischen Stickstoff direkt für sich zu nutzen – durch Eingehen einer Symbiose mit einigen wenigen Arten stickstofffixierender Bakterien. Durch diese Veränderung wurde erheblich mehr Stickstoff für das Wachstum der Landpflanzen verfügbar gemacht.
  • Welche Erkenntnisse führten dazu, dass die Bakterien und Archaeenals getrennte Domänen betrachtet wurden?

    Lösung

    Vor der Entwicklung der DNA-Sequenzierung fassten Biologen gewöhnlich alle Prokaryoten zu einer Gruppe zusammen und stellten die Unterschiede zu den Eukaryoten heraus. Bei vielen Merkmalen, in denen diese beiden Gruppen voneinander abweichen (wie dem Vorhandensein eines Zellkerns oder der verschiedenen Organellen), handelt es sich jedoch um abgeleitete Merkmale der Eukaryoten. Ende der 1970er-Jahre wurden die Archaeen als eigene, von den Bakterien getrennte Gruppe von Prokaryoten entdeckt. Beim späteren Vergleich der Gensequenzen der unterschiedlichsten Organismen (insbesondere der Gene für ribosomale RNA, die sich leicht bei allen untersuchten Lebewesen vergleichen lassen) zeigte sich schließlich, dass unter den Prokaryoten eine sehr viel größere Vielfalt zu verzeichnen war als unter den Eukaryoten. Recht schnell wurde deutlich, dass die rRNA-Gene von Archaeen tatsächlich denen von Eukaryoten erheblich mehr ähnelten als den rRNA-Genen von Bakterien. Daraufhin wurden die Archaeen endgültig als eigenständige Domäne von den Bakterien abgetrennt. Die biochemischen Untersuchungen von Archaeen ergaben, dass diese sich auch in zahlreichen anderen Merkmalen von den Bakterien unterscheiden.
  • Wie entstanden die Eukaryoten und welche evolutionären Beiträge steuerten die Archaeen bzw. Bakterien dazu bei?

    Lösung

    Die Gene in den Genomen von Eukaryoten sind überwiegend näher mit denen von Archaeen verwandt als mit jenen von Bakterien. Daraus folgerten Biologen, dass in einer ursprünglichen Linie der Archaeen erstmals die für Eukaryoten charakteristischen Merkmale (wie der Zellkern) entstanden. Diese frühen Eukaryoten nahmen dann durch Endosymbiose ein Proteobakterium auf, aus dem letztendlich die eukaryotischen Mitochondrien hervorgingen. Später kam es in einer Eukaryotengruppe zu einer weiteren Endosymbiose, dieses Mal wurde ein frühes Cyanobakterium aufgenommen. Daraus entwickelten sich schließlich die Chloroplasten der photosynthetisch aktiven Eukaryoten.
  • Betrachten Sie die Unterschiede zwischen Prokaryoten und Eukaryoten. Warum ähneln Eukaryoten in manchen Merkmalen eher Archaeen und in anderen eher Bakterien?

    Lösung

    Die Ähnlichkeiten zwischen den jeweiligen Gruppen können folgende Ursachen haben: 1. Das bei zwei Gruppen ähnliche Merkmal ist ein ancestrales (ursprüngliches) Merkmal des Lebens, bei der dritten Gruppe liegt es in der abgeleiteten Form vor. 2. Bei dem ähnlichen Merkmal handelt es sich um ein abgeleitetes Merkmal, es deutet somit auf einen gemeinsamen Ursprung der Gruppen hin (wie bei den Archaeen und ihren eukaryotischen Verwandten). Die dritte Gruppe (die Bakterien) ist durch den ancestralen Zustand dieses Merkmals charakterisiert. 3. Die beiden Endosymbioseereignisse, durch die Eukaryoten Bakterien aufgenommen haben, könnten Ähnlichkeiten zwischen Bakterien und Eukaryoten zur Folge gehabt haben. Ein Beispiel für die erste Kategorie ist das Fehlen eines Zellkerns bei beiden prokaryotischen Gruppen, während Eukaryoten einen Zellkern (ein abgeleitetes Merkmal) besitzen. Die Ähnlichkeit der RNA-Polymerasen von Archaeen und Eukaryoten ist vermutlich ein Beispiel für die zweite Kategorie (ein abgeleitetes Merkmal, das auf eine evolutionäre Verwandtschaft zwischen diese beiden Gruppen schließen lässt). Ein mögliches Beispiel für die dritte Kategorie sind die über Esterbindungen verknüpften Membranlipide von Bakterien und Eukaryoten, denn bei den Archaeen sind die Membranlipide über Etherbindungen miteinander verbunden.
  • Es ist davon auszugehen, dass sämtliche Organismenarten seit ihrer gemeinsamen Entstehung für gleich lange Zeit evolviert sind. Was würden Sie jemandem entgegenhalten, der behauptet, Prokaryoten seien „primitiv"? Bekräftigen Sie Ihre Antwort durch mindestens zwei Beispiele großer Gruppen von Prokaryoten.

    Lösung

    Sämtliche heute und früher lebenden Organismen stammen von einem gemeinsamen Vorfahren ab. Zahlreiche Modifikationen haben all die verschiedenen prokaryotischen wie auch eukaryotischen Arten hervorgebracht. Viele Prokaryoten haben radikale Veränderungen erfahren und können daher extreme Lebensräume besiedeln oder haben ungewöhnliche Lebensweisen bzw. Stoffwechselwege entwickelt. Dafür lassen sich zahllose Beispiele anführen, etwa die folgenden: Eine Gruppe der Euryarchaeota, die extrem Halophilen (salzliebende Organismen), bewohnt ausschließlich Lebensräume mit hohem Salzgehalt; manche dieser Organismen können in Seen mit dem hohen pH-Wert von 11,5 existieren. Das Überleben in solchen Umgebungen wird durch zahlreiche Anpassungen ermöglicht. In dieser Hinsicht sind diese Organismen also stärker abgeleitet als sämtliche Eukaryoten. Ein weiteres Beispiel bilden mehrere Bakteriengruppen, die wie die Chlamydien als stark abgeleitete intrazelluläre Parasiten leben. Ihre zahlreichen abgeleiteten Merkmale ermöglichen es ihnen, sehr kleine Zellen auszubilden, sodass sie in den Zellen anderer Organismen leben können. Somit sind die Begriffe „ursprünglich" und „abgeleitet" nur im Hinblick auf ein bestimmtes Merkmal des Organismus sinnvoll. Kein rezentes Lebewesen kann im Gesamten als primitiv gelten (d.h., der gemeinsame Vorfahre allen Lebens unterschied sich sehr deutlich von sämtlichen heute lebenden Organismen).
  • Wie bilden sich Biofilme und warum sind diese für die Wissenschaft so interessant?

    Lösung

    Biofilme repräsentieren komplexe Lebensgemeinschaften aus Mikroorganismen, die gemeinsam in einer schleimartigen Polysaccharidmatrix leben. Viele frei lebende Prokaryoten heften sich bei Kontakt mit einer Oberfläche an diese an und sondern zum Schutz für die Zellen ein klebriges Polysaccharid oder Protein als Matrix ab. Diese Zellen können dann Signalmoleküle aussenden, die andere Mikroorganismen zur Matrix locken. Dadurch entwickelt sich diese im Laufe der Zeit zu einer komplexen Lebensgemeinschaft verschiedener Organismen. Diese kann sich als ausgesprochen widerstandsfähig gegenüber Angriffen erweisen, sodass es äußerst schwierig sein kann, sie zu entfernen. Biofilme sind für die menschliche Gesundheit und die Industrie von erheblichem Interesse, denn sie können sich auf sämtlichen festen Oberflächen bilden (z.B. auf Zähnen, Kontaktlinsen, künstlichen Gelenken oder auf der Innenseite von Rohren) und so deren Abbau fördern. Auch für die Evolution zahlreicher Gemeinschaften vielzelliger Organismen wie den Stromatolithen kam Biofilmen entscheidende Bedeutung zu.
  • Warum wäre es aus gesundheitlichen Gründenproblematisch, alle Bakterien aus dem Verdauungstrakt eines Menschen zu beseitigen?

    Lösung

    Bakterien bilden die Voraussetzung für eine gesunde Verdauung. Nur sehr wenige Formen sind Krankheitserreger. Der Mensch macht sich einige der Stoffwechselprodukte der Darmbakterien wie die Vitamine B12 und K zunutze. Zudem ist der menschliche Darm mit einem dichten Biofilm aus großen Bakteriengemeinschaften ausgekleidet. Dieser Biofilm erleichtert die Aufnahme von Nährstoffbausteinen aus dem Darm in den Körper. Daher ist das Mikrobiom des Darms so wichtig für unsere Gesundheit.
  • Warum ist der Stickstoffmetabolismus von Prokaryoten so lebenswichtig für andere Organismen?

    Lösung

    Stickstofffixierende Prokaryoten verwandeln atmosphärischen, molekularen Stickstoff in eine für andere Lebewesen nutzbare chemische Form. Zusätzlich setzen die denitrifizierenden Bakterien organischen Stickstoff wieder als Gas in die Atmosphäre frei und sorgen so dafür, dass der Stickstoff nicht in die Meere ausgewaschen wird. Somit halten diese beiden Bakteriengruppen (die Stickstofffixierer und die Denitrifizierer) den Stickstoffkreislauf am Laufen und machen ein Leben an Land möglich.
  • Inwiefern werden phylogenetische Analysen von Viren durch die Größe viraler Genome eingeschränkt?

    Lösung

    Die Genome der meisten Viren sind stark reduziert und umfassen daher nur wenige Sequenzen, die man mit denen anderer Organismen vergleichen kann. Zudem evolvieren die Genome vieler Viren recht schnell und erschweren Vergleiche zusätzlich. Aufgrund ihres reduzierten Baus bieten Viren nur wenige morphologische Hinweise auf ihre Verwandtschaftsbeziehungen, und wegen ihrer geringen Größe bilden sie keine Fossilien. Viren sind in der Geschichte des Lebens mehrere Male unabhängig voneinander entstanden und daher mit Organismen von verschiedenen Stellen im Stammbaum des Lebens verwandt. Aus all diesen Gründen lassen sich Viren häufig nur schwierig präzise in diesem Stammbaum einordnen.
  • Erläutern Sie die beiden wesentlichen Hypothesen zur Entstehung der Viren.

    Lösung

    Bei vielen Viren handelt es sich vermutlich um frei gewordene Bestandteile zellulärer Organismen, die sich nun unabhängig von ihren Wirten weiterentwickeln. Andere Viren repräsentieren wahrscheinlich hochgradig reduzierte parasitische Organismen, die aus zellulären Vorfahren hervorgingen. Mit zunehmender Unabhängigkeit von ihren zellulären Vorfahren gingen ihre zellulären Strukturen verloren.
  • Wie kann man Viren zur Behandlung von Krankheiten des Menschen einsetzen?

    Lösung

    Als Bakteriophagen – oder kurz Phagen – bezeichnete Viren infizieren Bakterienzellen und töten diese ab. Bei der erstmals während des Ersten Weltkriegs entwickelten Phagentherapie werden diese Phagen medizinisch eingesetzt und sollen pathogene Bakterien abtöten. Ab den 1930er- und 1940er-Jahren wurde die Phagentherapie weitgehend durch den Einsatz von Antibiotika abgelöst. Da inzwischen allerdings immer mehr Bakterien Resistenzen gegenüber Antibiotika entwickeln, ist die Phagentherapie wieder zu einem aktiven Forschungsgebiet geworden.
  • Warum war die Entwicklung einer flexiblen Zelloberfläche ein entscheidendes Ereignis für die Evolution der Eukaryoten?

    Lösung

    Der Verlust der starren prokaryotischen Zellwand ermöglichte eine Einfaltung der Plasmamembran. Dadurch wurde die Zelloberfläche stark vergrößert, ohne dass die Zelle dadurch an Volumen zunahm. Zudem ermöglichten diese Einfaltungen eine stärkere Strukturierung innerhalb der Zelle und führten schließlich zur Evolution des endoplasmatischen Reticulums.
  • Erklären Sie, inwiefern die zunehmende Verfügbarkeit von atmosphärischem Sauerstoff (O2) die Evolution der eukaryotischen Zelle beeinflusst haben könnte.

    Lösung

    Bei der geringen Sauerstoffkonzentration der Atmosphäre in der Frühzeit der Erdgeschichte waren die Organismen nur zu einer anaeroben Atmung imstande. Die zunehmende Verfügbarkeit von molekularem Sauerstoff ermöglichte die Entwicklung der aeroben Atmung, die viel schneller abläuft und vom Energiegewinn erheblich effizienter ist als die anaerobe Atmung. Mit zunehmender Zellgröße hätte sich jedoch ohne die Einfaltungen der Plasmamembran das Verhältnis von Oberfläche zum Volumen der Zelle verringert. Des Weiteren führte der gestiegene Sauerstoffgehalt der Atmosphäre auch zur Endosymbiose eines aeroben Bakteriums (dem Vorläufer der eukaryotischen Mitochondrien); dies machte die Evolution aerober Eukaryoten erst möglich.
  • Erläutern Sie, warum sich der Begriff „Protisten" nicht (mehr) auf eine offizielle taxonomische Gruppe bezieht.

    Lösung

    Der Begriff „Protisten" wird als vereinfachende Umschreibung für eine vielfältige Gruppe entfernt miteinander verwandter, polyphyletischer eukaryotischer Organismen verwendet, von denen viele Einzeller sind. Manche Protisten sind näher mit jeder der drei Großgruppen vielzelliger Eukaryoten (Landpflanzen, echte Pilze und Tiere) verwandt als miteinander.
  • Beschreiben Sie für jedes der unten genannten Paare von Protistengruppen, wie Sie Mitglieder dieser beiden Gruppen erkennen und voneinander unterscheiden könnten.
    a. Foraminiferen und Radiolarien
    b. Ciliaten und Dinoflagellaten
    c. Diatomeen und Braunalgen
    d. Echte und Zelluläre Schleimpilze

    Lösung

    a. Foraminiferen besitzen ein Außengehäuse aus Calciumcarbonat (Kalk), Radiolarien zeichnen sich durch lange, starre Pseudopodien und eine Radiärsymmetrie aus. Sowohl die Schalen der Foraminiferen als auch die Endoskelette der Radiolarien sind wesentliche Bestandteile von Meeressedimenten und Sedimentgesteinen.
    b. Der Körper von Ciliaten ist mit zahllosen haarähnlichen Cilien (Wimpern) besetzt, Dinoflagellaten dagegen besitzen gewöhnlich zwei Geißeln (eine davon in einer Quer- und die andere in einer Längsfurche der Zelle). In beiden Gruppen finden sich als Alveolen bezeichnete Aussackungen direkt unter der Plasmamembran; sie sind das namensgebende Merkmal der Alveolata.
    c. Diatomeen (Kieselalgen) sind einzellig und normalerweise (wie eine Schuhschachtel) aus zwei Schalenhälften zusammengesetzt. Dagegen handelt es sich bei Braunalgen um vielzellige Organismen mit fädig verzweigtem (filamentösem) oder blattähnlichem (thallösem) Bau. Beide Gruppen betreiben Photosynthese.
    d. Die vegetative Einheit der Echten Schleimpilze bildet das Plasmodium: eine zellwandlose Cytoplasmamasse, die zahlreiche diploide Zellkerne enthält. Im Gegensatz dazu besteht die vegetative Einheit der Zellulären Schleimpilze aus einzelnen, voneinander getrennten, amöboiden Zellen. In beiden Gruppen bilden die vegetativen Einheiten unter ungünstigen Umweltbedingungen Fruchtkörper.
  • Aus dem Präkambrium liegen im Vergleich zum Kambrium und späteren geologischen Perioden nur spärliche Fossilbelege von Eukaryoten vor – obwohl die Eukaryoten bereits in der letzten Milliarde Jahre des Präkambriums eine Radiation durchliefen. Schlagen Sie einige Gründe dafür vor, warum aus dem Kambrium sehr viel mehr Fossilien von Eukaryoten gefunden wurden.

    Lösung

    Bis zu Beginn des Kambriums waren die meisten Eukaryoten einzellig. Durch die rasche Radiation, zunehmende Körpergröße der vielzelligen Eukaryoten (insbesondere der Tiere) und die neu erworbene Fähigkeit zur Biomineralisation ab dem frühen Kambrium erhöhte sich die Wahrscheinlichkeit der Fossilisierung beträchtlich. Im Folgenden sind Beispiele aufgeführt, auch andere Antworten sind möglich:
  • Nennen Sie jeweils Beispiele für Vertreter der Alveolata, Stramenopiles und Excavata, die aus medizinischen Gründen und für die menschliche Ernährung von Bedeutung sind.

    Lösung

    a. Alveolata: Dinoflagellaten können toxisch sein (sie können z.B. im Verlauf von roten Tiden Muscheln vergiften). Die zu den Apicomplexa zählende Gattung Plasmodium verursacht Malaria.
    b. Stramenopiles: Manche Braunalgen werden vom Menschen geerntet und deren Alginate als Emulgatoren in Eiscreme, Kosmetika und anderen Produkten verwendet.
    c. Excavata: Giardia lamblia, ein parasitischer Vertreter der Diplomonaden, verursacht die Darmkrankheit Giardiasis oder Lamblienruhr (diese Infektionskrankheit ist z.B. an der Reisediarrhö beteiligt). Unter den Kinetoplastida finden sich einige bedeutende pathogene Trypanosomenarten; sie verursachen Krankheiten wie Schlafkrankheit, Chagas-Krankheit und Leishmaniose.
  • Warum gilt die Konjugation zwischen Paramecien als sexueller Vorgang, aber nicht als Reproduktionsprozess?

    Lösung

    Zwei Paramecien tauschen bei der Konjugation genetisches Material aus, die Zahl der Individuen erhöht sich aber nicht. Infolgedessen handelt es sich zwar um einen sexuellen Vorgang (Austausch von genetischem Material), aber nicht um eine Fortpflanzung.
  • Warum sterben Ihrer Ansicht nach Paramecien nach etwa 350 Runden asexueller Fortpflanzung aus, wenn man ihre Konjugation verhindert?

    Lösung

    Durch den Austausch genetischen Materials bei der Konjugation können nachteilige Mutationen durch genetische Rekombination beseitigt werden. Ohne Konjugation können sich Paramecien nur klonal fortpflanzen, und das funktioniert wegen der Ansammlung negativer Mutationen nicht über längere Zeiträume.
  • Obwohl die meisten diploiden Tiere auch haploide Stadien aufweisen (d.h. Ei- und Spermienzellen), gilt dieserEntwicklungszyklus nicht als Beispiel für einen Generationswechsel. Warum ist das so?

    Lösung

    An einem Generationswechsel müssen unabhängige vielzellige haploide und diploide Stadien beteiligt sein. Spermien- und Eizellen sind aber einzellig und auch keine unabhängigen Organismen.
  • Welche Funktion haben weibliche Stechmücken der Gattung Anopheles bei der Übertragung von Malaria?

    Lösung

    Die weiblichen Stechmücken übertragen die parasitischen Plasmodien auf die menschlichen Wirte. Wenn die Stechmücken an einem infizierten Wirt Blut saugen, nehmen sie dabei die Plasmodien auf und übertragen diese dann beim Blutsaugen an weiteren, zuvor nicht infizierten Menschen auch auf diese.
  • Erläutern Sie die Rolle der Dinoflagellatenfür die sehr unterschiedlichen Phänomene der Korallenbleiche und der roten Tiden.

    Lösung

    Als rote Tiden bezeichnet man Massenvermehrungen (Blüten) planktischer Protisten (häufig Dinoflagellaten) in den Meeren (bisweilen auch in Süßgewässern) der Erde. Viele der an roten Tiden beteiligten Dinoflagellaten produzieren Giftstoffe, die für zahlreiche andere Arten tödlich sind, insbesondere für Fische und andere Wirbeltiere. Dinoflagellaten sind aber auch bedeutende Endosymbionten von Korallen. Sich verändernde Umweltbedingungen können zur Folge haben, dass die Dinoflagellaten absterben oder von ihren Wirtskorallen abgestoßen werden. Dadurch bleichen die Korallen aus. Sofern es den Korallen nicht gelingt, neue Dinoflagellaten aufzunehmen, werden sie schließlich immer schwächer und sterben ab.
  • Inwiefern sind Diatomeen von Bedeutung für die menschliche Gesellschaft? Nennen Sie zwei Beispiele.

    Lösung

    In vielen Ökosystemen sind Diatomeen wichtige Primärproduzenten. Für den Menschen sind sie aber in anderer Hinsicht viel bedeutender: Erdöl und Erdgas gehen hauptsächlich auf Öle und anderes organisches Material aus Diatomeen zurück. Außerdem entsteht aus den Überresten der Schalen von Diatomeen Kieselerde (Kieselgur), die zu Isolationszwecken, als Filtermasse, zum Polieren oder als Insektizid eingesetzt wird.
  • Erklären Sie die verschiedenen Möglichkeiten, wie der Begriff „Pflanze" verwendet werden kann.

    Lösung

    Bei der umfassendsten Verwendung bezieht sich der Begriff „Pflanzen" auf sämtliche Eukaryoten, die von dem Vorfahren abstammen, welcher als Erster primäre Endosymbionten aufgenommen hat, aus denen dann die Chloroplasten hervorgingen: Glaucophyten, Rotalgen, die verschiedenen Linien der Grünalgen und Landpflanzen. Andere beschränken den Begriff auf die Grünen Pflanzen (Chlorobionta), also jene, die Chlorophyll b enthalten (die Grünalgen und Landpflanzen). Meistens sind mit dem Begriff „Pflanzen" jedoch ausschließlich die Landpflanzen (Embryophyta) gemeint.
  • Warum umschreibt der Begriff „Algen" keine offizielle taxonomische Gruppe?

    Lösung

    Der Begriff „Algen" ist lediglich eine praktische Umschreibung für zahlreiche nicht näher miteinander verwandte Gruppen photosynthesebetreibender aquatischer Organismen, die alle zu den Protisten gehören. Darunter sind auch viele Eukaryotengruppen, die nicht zu den Plantae zählen.
  • Nennen Sie einige wesentliche Unterschiede zwischen den Glaucophyten, den Rotalgen und den verschiedenen monophyletischen Gruppen der Grünalgen.

    Lösung

    Die Glaucophyten sind einzellig und unterscheiden sich darüber hinaus von den anderen Gruppen, weil ihre Chloroplasten zwischen der inneren Zellmembran und der Außenmembran eine geringe Menge Peptidoglykan enthalten. Die meisten Rot- und Grünalgen sind vielzellig. Rotalgen (Rhodophyta) besitzen das akzessorische Photosynthesepigment Phycoerythrin, das ihnen häufig eine rote Färbung verleiht, vor allem bei in tieferem Wasser lebenden Arten. Statt des Phycoerythrins weisen die Grünalgen neben Chlorophyll a, das auch bei den Glaucophyten und Rotalgen vorkommt, eine zweite Form von Chlorophyll auf, Chlorophyll b.
  • Durch welche Belege wird die phylogenetische Verwandtschaft der Landpflanzen mit den verschiedenen Gruppen aquatischer Grünalgen gestützt?

    Lösung

    Sowohl die Landpflanzen als auch die verschiedenen Gruppen der Grünalgen enthalten neben dem auch bei den Glaucophyten und Rotalgen vorkommenden Chlorophyll a zusätzlich Chlorophyll b. Mit einigen Linien der Grünalgen sind die Landpflanzen näher verwandt als mit anderen. Die am engsten mit den Landpflanzen verwandte Gruppe der Grünalgen sind die Armleuchteralgen (Charophyta). Zu den gemeinsamen Merkmalen dieser beiden Gruppen zählen geschützte Embryonen, eine Cuticula, ein vielzelliger Sporophyt sowie die Bildung von vielzelligen Gametangien und dickwandigen Sporen.
  • Erklären Sie, was man unter einem heterophasischen Generationswechsel versteht. Warum wird dieser Begriff nicht auch auf den Menschen angewendet?

    Lösung

    Als heterophasischen Generationswechsel bezeichnet man einen Entwicklungszyklus mit folgenden alternierenden Generationen: einer vielzelligen diploiden Sporophytengeneration, die durch Meiose Sporenproduziert, und einer vielzelligen haploiden Gametophytengeneration, die durch Mitose Gameten erzeugt. Beim Menschen und den meisten Tieren gibt es keine Generationswechsel mit alternierenden sexuellen und asexuellen vielzelligen Stadien. Bei ihnen entstehen durch Meiose Gameten (Keimzellen); mittels Mitosen erfolgen Wachstum und Aufrechterhaltung der Lebensfunktionen, aber nicht die Fortpflanzung. Manche Tiergruppen haben jedoch andere Formen von Generationswechseln.
  • Beschreiben Sie die entscheidenden Anpassungen der Pflanzen an ein Leben in terrestrischer Umgebung und gehen Sie darauf ein, inwiefern diese Anpassungen bei den Leber-, Laub-und Hornmoosen vorhanden sind.

    Lösung

    Folgende Anpassungen an eine terrestrische Lebensweise findet man bei allen großen Linien der Landpflanzen (einschließlich der Leber-, Laub- und Hornmoose): eine Cuticula, die mit ihrem wachsartigen Überzug aus Lipiden den Verlust von Wasser verringert; vielzellige Gametangien (Organe mit darin eingeschlossenen Gameten), die ein Austrocknen der Gameten verhindern; geschützte Embryonen; Pigmente, die vor ultravioletter Strahlung schützen; dickwandige Sporen; eine Symbiose mit Pilzen, welche die Aufnahme von Mineralstoffen aus dem Boden erleichtert. Spaltöffnungen (Stomata), kleine verschließbare Öffnungen in den Blättern und Sprossen zur Regulation des Gasaustauschs, sind eine Anpassung an ein Leben in terrestrischer Umgebung, die man bei allen Landpflanzen mit Ausnahme der Lebermoose findet.
  • Welche Funktionen erfüllen die Leitgewebe Xylem und Phloem für die Gefäßpflanzen?

    Lösung

    Im Xylem (Holz) werden Wasser und Mineralstoffe aus dem Boden in die oberirdischen Pflanzenteile transportiert. Zudem verleiht das Xylem der Pflanzen Stabilität. Im Phloem (Bast) erfolgt der Transport der Photosyntheseprodukte (Assimilate) von den Produktionsorten zu den Speicher- und Verbrauchsorten in der Pflanze.
  • Beschreiben Sie die Evolution und Verbreitung der verschiedenen Formen von Blättern und Wurzeln bei den Gefäßpflanzen.

    Lösung

    Die ersten wurzelartigen Strukturen waren Rhizome – horizontale Sprossabschnitte mit fädigen Strukturen zur Wasseraufnahme, die man als Rhizoide bezeichnet. Auch einige heutige Pflanzen besitzen noch Rhizoide, etwa die Lebermoose und die Laubmoose, und auch bei einigen Gefäßpflanzen kommen sie vor, beispielsweise bei den Farnen und Bärlappgewächsen. Die Farne und Bärlappe bilden wie die anderen Gefäßpflanzen auch echte Wurzeln aus, spezialisierte Organe zur Aufnahme von Wasser und Mineralstoffen aus dem Boden. Blätter sind bei den Gefäßpflanzen vermutlich zweimal unabhängig entstanden. Die einfachen Mikrophylle der Bärlappgewächse gingen wahrscheinlich aus sterilen Sporangien hervor. Die größeren und komplexeren Megaphylle – die echten Blätter – entwickelten sich dagegen vermutlich durch Abflachung von verzweigten Sprossen und Übergipfelung (Telomtheorie).
  • Erläutern Sie das Konzept der Heterosporie. Inwiefern bietet die Heterosporie gegenüber der Homosporie Selektionsvorteile?

    Lösung

    Unter Heterosporie versteht man die Ausbildung von zwei verschiedenen Sporentypen: weiblichen Megasporen und männlichen Mikrosporen. Aus Megasporen entwickeln sich die weiblichen Gametophyten (Megagametophyten), aus den Mikrosporen die männlichen (Mikrogametophyten). Ein Vorteil der Heterosporie ist, dass sie eine Kreuzung zwischen verschiedenen Individuen begünstigt. Die Tatsache, dass Heterosporie mehrere Male unabhängig aus Homosporie entstanden ist, belegt, dass der heterospore Zustand einen Selektionsvorteil bietet.
  • Die Samenpflanzen wurden unabhängig von einer äußeren Benetzung mit Wasser. Erklären Sie, welche Bedeutung hierbei den Pollenkörnern zukam.

    Lösung

    Pollenkörner sind äußerst widerstandsfähig gegen Austrocknung und können durch den Wind oder durch Bestäuber übertragen werden. Wenn ein Pollenkorn auf der Narbe einer Blüte landet, wächst ein Pollenschlauch aus, aus dem die Spermazellen direkt zum Megagametophyten (dem weiblichen Gametophyten) gelangen.
  • Inwiefern tragen Samen und die Samenruhe dazu bei, dass Pflanzen in Lebensräumen mit starken saisonalen Schwankungen besser überleben können?

    Lösung

    Samen schützen den Embryo vor zu starkem Austrocknen und vor Fressfeinden. Im Boden können Samen im Ruhestadium oft viele Jahre überdauern, bis wieder günstige Wachstumsbedingungen herrschen. Viele Samen begünstigen zudem die Ausbreitung durch den Wind, durch Wasser oder durch Tiere. In der frühen Wachstumsphase versorgt der Samen den sich entwickelnden Sporophyten mit den notwendigen Nahrungsreserven.
  • Welche Rolle spielte die Evolution des Holzes für die Veränderung der terrestrischen Lebensräume?

    Lösung

    Das Holz verlieh den Sprossen der Pflanzen Stabilität und ermöglichte ihnen, stark in die Höhe zu wachsen. Diese Neuerung ermöglichte die Entstehung von Wäldern.
  • Inwiefern ist Feuer für einige Gymnospermen lebensnotwendig?

    Lösung

    Manche Pflanzen sind auf Feuer angewiesen, damit die Samen freigesetzt werden. Beispielsweise benötigen einige Kiefern Feuer, damit sich ihre dicht geschlossenen Zapfen öffnen und die Samen freigeben. Erst dann können diese keimen.
  • Unterscheiden Sie zwischen der Rolle des Megagametophyten und jener des Pollenkorns im Entwicklungszyklus eines Nadelbaums.

    Lösung

    Der Megagametophyt ist der weibliche Gametophyt, das vielzellige haploide Gewebe, das in der Samenanlage aller Samenpflanzen enthalten ist. Beim Pollenkorn handelt es sich um den vielzelligen männlichen Gametophyten; er produziert die Spermazellen, die den Megagametophyten befruchten.
  • Welche Funktion haben die fleischigen Zapfen, die die Samen vieler Gymnospermen umgeben?

    Lösung

    Diese fleischigen Zapfen dienen wie die Früchte von Blütenpflanzen dazu, Tiere anzulocken. Die Tiere verzehren die Zapfen mitsamt den darin enthaltenen Samen. Die Samen passieren den Verdauungstrakt der Tiere meist unversehrt und werden dann mit dem Kot verbreitet.
  • Welche Rolle spielen die beiden Spermazellkerne bei der doppelten Befruchtung der Angiospermen?

    Lösung

    Aus der Verschmelzung der einen Spermazelle mit der Eizelle entsteht die diploide Zygote. aus einer weiteren Verschmelzung eines Spermazellkerns mit den Polkernen entsteht das (meist) triploide Endosperm, das als Nährgewebe der Ernährung des sich entwickelnden Embryos dient.
  • Erklären Sie den Unterschied zwischen Bestäubung und Befruchtung.

    Lösung

    Als Bestäubung bezeichnet man die Ankunft des Pollens auf einer Narbe. Nach Auswachsen des Pollenschlauchs aus dem Pollenkorn wird eine Spermazelle freigesetzt, gelangt zum Megagametophyten, und die Befruchtung erfolgt.
  • Nennen Sie einige Unterschiede zwischen Früchten, die Tieren als Nahrungsquelle dienen und diese so zur Verbreitung der Samen anlocken, und solchen, die für die Verbreitung an Tieren haften bleiben. Geben Sie jeweils Beispiele dafür an.

    Lösung

    Früchte, die als Nahrungsquelle Tiere anlocken sollen, haben zumeist fleischige, essbare Fruchtknoten. Tiere sammeln oder verzehren die Früchte, die Samen passieren unversehrt den Verdauungstrakt, werden mit dem Kot wieder abgegeben und keimen anschließend. In einigen Fällen, etwa bei Nüssen, sind die Samen selbst essbar und die Frucht dient als robuste Schutzhülle. Tiere wie Eichhörnchen sammeln die Nüsse, verzehren davon aber nur einige; die anderen vergraben sie als Vorrat. Von diesen vergrabenen Nüssen keimen dann viele und bilden neue Pflanzen. Im Gegensatz dazu haben manche Früchte eine klebrige Oberfläche und bleiben damit an Tieren hängen, die an der fruchtenden Pflanze vorbeistreichen. Vielleicht mussten Sie schon einmal von Ihrer Kleidung oder einem Hundefell Kletten entfernen und damit Früchte, die auf diese Weise verbreitet werden.
  • Welche unterschiedlichen Funktionen haben Blüten, Früchte und Samen?

    Lösung

    Blüten sind die Orte der Bestäubung und Befruchtung; bei vielen Arten erfüllen sie zudem die Funktion, Bestäuber anzulocken. Früchte können als schützende Hülle oder Mittel zur Verbreitung der Samen dienen; häufig sind die Früchte für ein Tier als Nahrungsquelle attraktiv, das die Samen dann mit seinem Kot verbreitet. Die Samen dienen als Schutz für die sich entwickelnden Embryonen, bis günstige Bedingungen für die Keimung herrschen.
  • Eine Ackerfläche wurde seit Jahrzehnten zum Anbau von Mais genutzt, aber nun gedeihen hier keine gesunden Pflanzen mehr. Tests zufolge mangelt es dem Boden an Stickstoff und organischen Substanzen. Eine Landwirtschaftsberaterin empfiehlt, Sojabohnen anzubauen und in künftigen Jahren einen Fruchtwechsel zwischen Sojabohnen und Mais vorzunehmen. Weiterhin rät sie, die Maisstoppeln nach der Ernte in den Boden einzuarbeiten. Warum wird dieses Vorgehen die Produktion wahrscheinlich wieder ankurbeln?

    Lösung

    Sojabohnen reichern Stickstoff an und entwickeln ein ausgeprägtes Wurzelwerk, das der Bodenerosion entgegenwirkt. Beides kommt dem Mais zugute. Die Maisstoppeln reichern den Boden mit Mineralstoffen und organischen Substanzen an.
  • Welche große Pflanzengruppe liefert (direkt oder indirekt) den Großteil der Energie, die der Mensch mit der Nahrung zu sich nimmt? Erläutern Sie Ihre Antwort.

    Lösung

    Zu den Gräsern zählen die wichtigen Getreidesorten (wie Reis, Weizen und Mais), die einen Großteil des Energiegehalts der menschlichen Ernährung ausmachen. Zudem bilden Gräser die Futtergrundlage für Weidetiere wie Rinder, die dem Menschen Fleisch und Milchprodukte liefern.
  • Inwiefern ermöglicht Pilzen ihr Bau eine heterotrophe Ernährung durch Absorption?

    Lösung

    Einzellige Pilze absorbieren Nährstoffe direkt aus ihrer Umgebung, bei vielzelligen Pilzen erfolgt die Absorption über als Hyphen bezeichnete Strukturen. In beiden Fällen geben die Pilze Verdauungsenzyme nach außen ab und absorbieren dann die Abbauprodukte über ihre Plasmamembranen. Die langen Hyphen vielzelliger Pilze bilden dünne Netzwerke, die in den Boden und in sich zersetzendes oder lebendes organisches Material eindringen können.
  • Welche Vor- und Nachteile bringt vielzelligen Pilzen das hohe Oberflächen/Volumen-Verhältnis ihres Mycels? Inwiefern schränkt das Mycel dieLebensräume, in denenPilze im Allgemeinen vorkommen, ein?

    Lösung

    Das hohe Oberflächen/Volumen-Verhältnis ermöglicht eine rasche Absorption über eine große Fläche, denn die Hyphen können in engen Kontakt mit der Nahrungsquelle treten. Dieser Bau kann allerdings auch zu einem raschen Wasserverlust und zum Austrocknen führen. Darum sind Pilze zumeist auf feuchte Lebensräume beschränkt (zumindest gedeihen sie dort am besten).
  • Welche Rolle spielen Pilze für den Kohlenstoffkreislauf der Erde?

    Lösung

    Pilze bauen organisches Material ab, insbesondere die Cellulose und das Lignin der Zellwände von Pflanzen, und überführen auf diese Weise den Kohlenstoff abgestorbener Pflanzen wieder in eine von anderen Organismen nutzbare Form. Zudem zersetzen Pilze das Keratin von Landwirbeltieren, das von Bakterien nicht abgebaut werden kann. Ohne Pilze würden sich diese Stoffe in der Umwelt anreichern und eine globale Kohlenstoffsenke darstellen.
  • Beschreiben Sie die Charakteristika von Flechten, und geben Sie an, welche Vorteile diese Symbiosen bieten.

    Lösung

    Bei Flechten handelt es sich um eine symbiotische Beziehung zwischen einem echten Pilz und einem photosynthesebetreibenden Partner (einer einzelligen Grünalge und/oder einem Cyanobakterium). Der Pilz erhält von seinen photosynthetisch aktiven Partner fixierten Kohlenstoff (in Form von organischen Verbindungen) und liefert ihm im Gegenzug Mineralien und Wasser. Von dieser Gemeinschaft profitieren sowohl der Pilz als auch der photosynthetisierende Partner; beispielsweise können sie gemeinsam in rauen Umgebungen wachsen (etwa auf Felsen oder auf der Rinde von Bäumen), in denen keiner der beiden Organismen alleine gut gedeihen – wenn überhaupt überleben – würde.
  • Inwiefern profitieren von einer Mykorrhiza sowohl die Pflanze als auch der Pilz?

    Lösung

    Ähnlich wie bei den Flechten gehen Mykorrhizapilze eine symbiotische Partnerschaft mit einer photosynthesebetreibenden Art ein, in diesem Fall mit einer vielzelligen Pflanze. Viele Pflanzen sind zum Überleben auf diese Mykorrhizagemeinschaften angewiesen. Die Pflanze liefert dem Pilz organische Verbindungen (die Produkte der Photosynthese), der Pilz versorgt die Pflanze mit Mineralstoffen und Wasser aus dem Boden. Durch das hohe Oberflächen/Volumen-Verhältnis der Pilzhyphen erhöht sich die Fähigkeit der Pflanzenbeträchtlich, Wasser und Mineralstoffe aufzunehmen. Außerdem wirken die Hyphen wie ein Schwamm und halten das Wasser im Bereich der Wurzeln fest.
  • Erläutern Sie das Konzept der Paarungstypen. Inwiefern unterscheiden sich diese von den Geschlechtern „männlich“ und „weiblich“?

    Lösung

    Die Paarungstypen sind, anders als ein männliches und weibliches Geschlecht, phänotypisch nicht zu unterscheiden; zudem existieren oftmals mehr als zwei Paarungstypen. Auch wenn zwischen den Paarungstypen morphologisch keine Unterschiede bestehen, so weichen die Paarungstypen innerhalb einer Art dennoch genetisch voneinander ab. Beispielsweise können sich Individuen derselben Art mit gleichem Paarungstyp meist nicht miteinander paaren. Männliches und weibliches Geschlecht sind dagegen durch ihre relative Größe oder ihre Gameten definiert. (Weibchen bilden große Gameten, Männchen kleine; für die Fortpflanzung müssen sich ein männlicher und ein weiblicher Gamet vereinigen.)
  • Beschreiben Sie, wie Mikrosporidien die Zellen ihrer tierischen Wirte infizieren.

    Lösung

    Mikrosporidien gehören zu den kleinsten bekannten Eukaryoten. Sie leben als obligate Parasiten von Tieren. In die Wirtszelle dringen sie über einen Polschlauch ein, durch den der Inhalt der Sporen in die Wirtszelle injiziert wird. Dieses Sporoplasma repliziert sich dann innerhalb der Wirtszelle und produziert neue infektiöse Sporen. Bei manchen Insekten können die parasitischen Mikrosporidien von infizierten Elterntieren auf die Nachkommen übertragen werden.
  • Welches Merkmal der Flagellatenpilze legt nahe, dass die Fungi von einem aquatischen Vorfahren abstammen?

    Lösung

    Die meisten Flagellatenpilze besitzen begeißelte Gameten, ihre Fortpflanzung erfolgt im Wasser (oder zumindest in feuchter Umgebung, etwa in feuchten Böden).
  • Welche Rolle spielt die Zygospore im Entwicklungszyklus der Jochpilze?

    Lösung

    Die Zygospore ist das diploide Stadium des Entwicklungszyklus von Jochpilzen. Sie besitzt eine dicke, mehrschichtige Zellwand und kann als Ruhestadium fungieren, das monatelang in einem Zustand der Dormanz verbleibt, bis die Umweltbedingungen günstig zum Keimen sind. Dann durchlaufen ihre diploiden Zellkerne eine Meiose, und die Zygospore bildet einen gestielten Sporangienträger (Sporangiophor) aus. Dieser trägt ein oder mehrere Sporangien. Jedes Sporangium enthält als Produkte der Meiose haploide Sporen.
  • Wie unterscheiden sich die Fruchtkörper der Schlauchpilze von denen der Ständerpilze?

    Lösung

    Die haploiden Ascosporen der Schlauchpilze sind in einem schlauchartigen Gebilde, dem Ascus, enthalten. Viele Schlauchpilzarten tragen diese Asci an becherförmigen Fruchtkörperm, die man als Ascocarpien bezeichnet. Im Gegensatz zu diesen becherförmigen Fruchtkörpern der Schlauchpilze sind uns die Fruchtkörper der Ständerpilze, die Basidiocarpien, vertrauter: Hierzu gehören Hutpilze, Boviste und Baumschwämme. An diesen Basidiocarpien sitzen die Basidien, in denen die Befruchtung und die Meiose stattfinden, durch die haploide Basidiosporen entstehen.
  • Nennen Sie einige Beispiele dafür, wie Pilze oder Pilzprodukte zur Ernährung des Menschen beitragen.

    Lösung

    Manche Pilze werden direkt verzehrt (vor allem Hutpilze, aber auch einige Flechten). Eine wichtigere Rolle spielen Pilze aber für die Herstellung von Brot (mittels Bier- bwz. Bäckerhefe), Käse (Pilze verleihen vielen Käsesorten ihren charakteristischen Geschmack) und alkoholischen Getränken (durch die Gärung der Hefen). Außerdem ermöglichen und verbessern Pilze das Wachstum zahlreicher Nutzpflanzen.
  • Welche Vorteile hat es gegenüber direkten Messungen der Luftschadstoffe, Untersuchungen zur Vielfalt der Flechten und Museumssammlungen von Flechten als Maß für langfristige Veränderungen der Luftqualität heranzuziehen?

    Lösung

    Die Flechtensammlungen in Museen repräsentieren indirekte Belege für die Luftqualität in der Vergangenheit. Das kann man sich insbesondere in Gebieten zunutze machen, in denen ursprünglich keine direkten Messungen der Luftqualität erfolgten. Daneben bieten Untersuchungen zur Artenvielfalt der Flechten eine schnelle und kostengünstige Möglichkeit, die Luftqualität in einem Lebensraum zu überwachen.
  • Versuchen Sie eine Strategie für eine nachhaltige Entnahme von Bäumen aus Wäldernzu entwickeln, bei der lebensfähige Gemeinschaften von Mykorrhizapilzen erhalten bleiben, und dadurch die beiWiederaufforstungsprojekten auftauchenden Schwierigkeiten zu verringern und die Kosten der Projekte zu senken.

    Lösung

    Durch selektives Abholzen von Bäumen statt einer kompletten Rodung lassen sich Wälder so bewirtschaften, dass weitgehend intakte Gemeinschaften vieler Organismen, einschließlich der Mykorrhizapilze, erhalten bleiben. Sofern man einige der ursprünglichen Waldbäume stehen lässt, gewährleistet dies, dass auch weiterhin lebensfähige Mykorrhizapilzgemeinschaften vorhanden sind. Dies erleichtert es erheblich, die entnommenen Bäume durch Neupflanzungen zu ersetzen.
  • Welche allgemeinen Merkmale von Tieren unterscheiden diese Gruppe von anderen Organismen?

    Lösung

    Bei den meisten Tieren handelt es sich um vielzellige, heterotrophe Organismen mit einer inneren Verdauung, einer Muskulatur, die eine Fortbewegung ermöglicht, und einem Nervensystem. Die Kombination dieser Merkmale ermöglicht es uns in der Regel, Tiere von anderen Organismengruppen zu unterscheiden. Allerdings kann keines dieser Merkmale alleine als diagnostisches Merkmal für sämtliche Tiere dienen. Andere Gruppen umfassen ebenfalls vielzellige Arten (wie Protisten, echte Pilze und Pflanzen); viele Protisten und Pilze ernähren sich heterotroph; manche Protisten haben eine innere Verdauung; und nicht alle Tiere besitzen eine Muskulatur oder ein Nervensystem. Belege für die Monophylie der Tiere stammen von Analysen der DNA-Sequenz und einigen wenigen Strukturmerkmalen auf biochemischer und mikroskopischer Ebene: gemeinsame Moleküle der extrazellulären Matrix, wie Kollagen und Proteoglykane, sowie einzigartige Zell-Zell-Verbindungen (Tight Junctions, Desmosomen und Gap Junctions).
  • Erläutern Sie jeweils die Unterschiede zwischen Vertretern der folgenden Gruppen:
    a. Protostomier (Urmünder)/Deuterostomier (Neumünder)
    b. zweikeimblättrige (diploblastische) Tiere/dreikeimblättrige (triploblastische) Tiere

    Lösung

    a. Bei den bilateralsymmetrischen Tieren lassen sich zwei unterschiedliche Formen der Gastrulation unterscheiden – der Einstülpung einer Hohlkugel (der Blastula) aus einer Zellschicht im Laufe der Entwicklung, durch die der Urmund (Blastoporus) entsteht: Bei den Protostomiern (Urmünder) entsteht aus dem Blastoporus schließlich der Mund des Tieres, während er bei den Deuterostomiern (Neumünder) zum After wird.
    b. Die Embryonen zweikeimblättriger (diploblastischer) Tiere besitzen zwei embryonale Zellschichten (Keimblätter) – das äußere und das innere Keimblatt (Ektoderm und Entoderm). Bei den Embryonen der dreikeimblättrigen (triploblastischen) Tiere befindet sich zwischen diesen beiden Keimblättern noch eine zusätzliche Zellschicht, das mittlere Keimblatt oder Mesoderm.
  • Auf welcher analytischen Basis wurden die beiden Großgruppen Lophotrochozoa und Ecdysozoa 1997 definiert?

    Lösung

    durch DNA-Sequenz-Analysen
  • Erläutern Sie jeweils die Unterschiede zwischen Vertretern der radiärsymmetrischen und der bilateralsymmetrischen Tiere.

    Lösung

    Bei einer Radiärsymmetrie befinden sich die Körperteile in mehreren Symmetrieebenen um eine zentrale Achse. Radiärsymmetrische Tiere besitzen kein Vorder- oder Hinterende und leben oft sessil (festsitzend) oder treiben als Bestandteil des Planktons frei im Wasser. Wenn sie sich aus eigener Kraft fortbewegen, dann erfolgt dies zumeist langsam, aber gleich gut in alle Richtungen. Bilateralsymmetrische Tiere sind durch spiegelbildliche rechte und linke Hälften gekennzeichnet, geteilt durch eine einzelne Symmetrieebene, die in Längsrichtung des Körpers entlang der Mittellinie verläuft. An ihrem Vorderende sind gewöhnlich in einem abgesetzten Kopf Sinnesorgane und Nervengewebe konzentriert. Normalerweise bewegen sich bilateralsymmetrische Tiere vorwärts in Richtung des Kopfes fort. Auf diese Weise trifft der Kopf als Erstes auf neue Umgebungen.
  • Warum ist Bilateralsymmetrie stark mit einer Cephalisation (Kopfbildung) – der Konzentration von Sinnesorganen, Nervenzentren und Mundwerkzeugenineinem am Vorderende liegenden Kopf – korreliert?

    Lösung

    Bilateralsymmetrische Organismen weisen ein anteriores Ende (Vorderende) und ein posteriores Ende (Hinterende) auf. Bei der Bewegung durch die Umgebung stößt ein Tier mit dem Vorderende zuerst auf potenzielle Nahrung oder Feinde. Daher ist es von Vorteil, dass die Sinnesorgane, das Zentralnervensystem und die Mundwerkzeuge am Vorderende konzentriert sind.
  • Nennen und erläutern Sie mehrere Möglichkeiten, wie Leibeshöhlen, Segmentierung und Zentralnervensysteme eine bessere Steuerung von Bewegungen ermöglichen können.

    Lösung

    Die Leibeshöhlen vieler Tiere fungieren als hydrostatisches Skelett (Hydroskelett). Bei der Kontraktion der Muskeln um eine Leibeshöhle muss die enthaltene Flüssigkeit in einen anderen Bereich des Körpers ausweichen. Auf diese Weise sind die Tiere imstande, bestimmte Körperteile auszustrecken und zu bewegen. Die Segmentierung ermöglicht eine Spezialisierung der Körperteile. Tiere mit weichem Körper können die Form jedes Körperteils unabhängig verändern und dadurch die Präzision von Bewegungen erhöhen. Bei Tieren mit einem harten Außenskelett (Exoskelett) wie den Gliederfüßern (Arthropoden) ermöglichen die Segmentierung und die damit einhergehenden Körperanhänge (Extremitäten; gesteuert durch Muskeln, die am Exoskelett ansitzen) eine noch stärkere Spezialisierung der Bewegungen. Arthropoden nutzen ihre Extremitäten zum Beispiel zum Laufen, Schwimmen oder zur Nahrungsaufnahme. Das Zentralnervensystem dient der Wahrnehmung der Umwelt (einschließlich Nahrung, geeigneten Temperaturen und potenziellen Feinden) sowie der Koordination von Bewegungen.
    Acoelomaten Tieren fehlt eine Leibeshöhle. Bei pseudocoelomaten Tieren ist die Leibeshöhle nur außen von mesodermalem Gewebe umgeben, aber nicht der Darm und die inneren Organe, die entodermaler Herkunft sind. Coelomate Tiere besitzen eine sekundäre Leibeshöhle (Coelom), die ebenso von mesodermalem Gewebe umhüllt ist wie die inneren Organe.
  • Welche Unterschiede bestehen zwischen Filtrierern, Carnivoren und Parasiten, die sich alle von anderen Tieren ernähren?

    Lösung

    Filtrierer filtern kleine Nahrungspartikel aus dem Wasser; darunter können auch kleine Tiere sein. Im Normalfall verfolgen Filtrierer aber nicht aktiv einzelne Beuteindividuen. Carnivoren suchen dagegen aktiv nach ihren Beutetieren und töten sie schließlich. Parasiten ernähren sich ebenfalls von anderen Tieren, in der Regel jedoch ohne diese dabei zu töten. Ein Parasit kann in seinem Wirtstier leben (als Endoparasit) oder er lebt auf seinem Wirt (als Ektoparasit) und erlangt von dort seine Nahrung (wie Stechmücken oder Zecken).
  • Welche Anpassungen müssen Tiere haben, die sich von Pflanzen ernähren? Und welche Anpassungen werden für eine carnivore Lebensweise benötigt?

    Lösung

    Herbivoren müssen relativ derbes, faserhaltiges Pflanzenmaterial verdauen können. Dafür benötigen sie gewöhnlich einen (im Vergleich zu Carnivoren) längeren Verdauungstrakt, der eine Fermentierung des Pflanzenmaterials ermöglicht. Zum Kauen von Blättern und anderen Pflanzenteilen oder zum Saugen von Pflanzensäften benötigen sie spezielle Mundwerkzeuge. Ein Carnivore muss beweglich sein, um seine Beute fangen zu können, und über Anpassungen verfügen, die es ihm ermöglichen, seine Beute zu überwältigen (wie Zähne, Kiefer, Klauen, Gifte usw.).
  • Warum kann kein Entwicklungszyklus evolvieren, der für alle Aspekte der Ernährung und Fortpflanzung gleichermaßen optimal ist?

    Lösung

    Im typischen Fall sind die Eigenschaften eines Tieres in einem bestimmten Lebensstadium unter einigen Bedingungen vorteilhaft, unter anderen nachteilig. Veränderungen, die sich auf ein Merkmal günstig auswirken, wie beispielsweise eine dickere Schale zum Schutz vor Feinden, gehen gewöhnlich mit irgendwelchen Kosten einher, in diesem Fall mit einer verringerten Mobilität und einem erhöhten Stoffwechselaufwand. Der Entwicklungszyklus eines Tieres kann so evolvieren, dass mehr Eier produziert werden, aber das geht in der Regel nur auf Kosten der Ressourcen, die in die einzelnen Eier investiert werden können. Dies führt wiederum dazu, dass die Nachkommen im Durchschnitt eine geringere Überlebenswahrscheinlichkeit aufweisen. Aus diesem Grund sind Abwandlungen von Entwicklungszyklen im Laufe der Evolution Grenzen gesetzt.
  • Inwiefern unterscheidet sich eine Kolonie einzelliger Organismen von einem (vielzelligen) Tier?

    Lösung

    Bei einem vielzelligen Lebewesen weist jede Zelle den gleichen Genotyp auf, und alle Zellen sind physiologisch miteinander verbunden, voneinander abhängig und bilden einen funktionsfähigen Organismus. Bei koloniebildenden Arten sind die einzelnen Individuen einer Kolonie weniger eng miteinander assoziiert und können auch imstande sein, unabhängig voneinander zu existieren. In manchen Fällen besitzen die verschiedenen Individuen einer Kolonie unterschiedliche Genotypen; allerdings gibt es auch Kolonien, die aus klonal vervielfältigten Individuen bestehen und als einheitliches Ganzes funktionieren. Im Gegensatz zu den einzelnen Zellen vielzelliger Individuen ist jedes Individuum einer Kolonie in der Regel selbst vielzellig.
  • Auf welcher Grundlage baut die Hypothese auf, dass die Nervensysteme bei den Rippenquallen, den Nesseltieren und den Bilateria unabhängig voneinander evolviert sind?

    Lösung

    Erstens zeigten phylogenetische Analysen, dass die Rippenquallen (Ctenophora) die Schwestergruppe der anderen Tiere sind. Im Gegensatz zu manchen anderen Tieren (wie Schwämmen und Placozoen) besitzen Rippenquallen ein Nervensystem. Daher müssen sich Nervensysteme entweder einmal bei dem Vorfahren aller Tiere entwickelt haben und sind dann später bei den Schwämmen und Placozoen wieder verloren gegangen, oder die Nervensystem sind bei den Rippenquallen und den übrigen Tieren unabhängig voneinander evolviert. Zweitens ergaben Analysen vollständiger Genome, dass die an der Ausbildung von Nervensystemen beteiligten Gene bei Rippenquallen, Nesseltieren (Cnidaria) und Bilateria eine unabhängige Duplikation und Spezialisierung durchlaufen haben. Das deutet darauf hin, dass sich die Nervennetze von Rippenquallen und Nesseltieren sowie das Zentralnervensystem der Bilateria unabhängig voneinander entwickelt haben.
  • Warum gelten Schwämme und Placozoen als Tiere, obwohl sie keinen komplexen Körperbau aufweisen, der die meisten anderen Tiergruppen auszeichnet?

    Lösung

    Die als „Tiere" bezeichnete Organismengruppe repräsentiert ein spezifisches Monophylum vielzelliger Lebewesen im Stammbaum des Lebens. Bei Schwämmen sind noch viele der ursprünglichen Merkmale von Verwandten der Tiere (wie den Choanoflagellaten) erhalten geblieben. Sie haben sich noch vor der Evolution komplexer Organsysteme von den anderen Tieren abgespalten. Bei den Placozoen könnte die Einfachheit hingegen sekundärer Natur sein: Möglicherweise leiten sie sich von Vorfahren mit ausgeprägten Organsystemen ab, die dann offenbar wieder verloren gegangen sind.
  • Die Entdeckung, dass in warmen Gewässern in großer Zahl pelagische (im freien Wasser schwimmende) Stadien von Placozoen vorkommen und dass diese sich im ausgereiften Stadium auf glatten Oberflächen ansiedeln, legt nahe, wie man diese Organismen sammeln und erforschen könnte. Welche Sammelmethode würde Sie vorschlagen, um festzustellen, ob an einer bestimmten Stelle entlang einer Küste Placozoenleben?

    Lösung

    Wenn man in warmen tropischen Gewässern Objektträger aus Glas (oder andere glatte Objekte als Substrate für Placozoen) ausbringt, dann siedeln sich darauf häufig Placozoen an. Also könnte man in einem Untersuchungsgebiet solche Objektträger im Wasser aufhängen und nach einer gewissen Zeit auf die Anwesenheit von Placozoen überprüfen.
  • Wie wirkt sich die Körperhülle eines Tieres auf seinen Gasaustausch, seine Ernährungsweise und Fortbewegungsweise aus?

    Lösung

    Eine weiche Körperhülle erhöht die Flexibilität und Anpassungsfähigkeit des Körpers und versetzt Tiere in die Lage, sich auch in beengtem Raum fortzubewegen. Außerdem ermöglicht sie einen direkten Austausch von Gasen und Flüssigkeiten mit der Umgebung. Bei Tieren mit weichem Körper erfolgt die Fortbewegung größtenteils mittels eines Hautmuskelschlauchs, der auf das hydrostatische Skelett (Hydroskelett) einwirkt. Dagegen bietet eine harte Außenhülle (Exoskelett) besseren Schutz vor Räubern und Austrocknung und sie stellt Ansatzstellen zur Verankerung der Muskeln für Extremitäten bereit, die der Fortbewegung oder der Nahrungsaufnahme dienen können. Die Atmung muss bei Tieren mit einem harten Außenskelett durch Öffnungen nach außen und den Austausch von Gasen innerhalb des Körpers erfolgen.
  • Durch welche Merkmale sind die Arthropoden so gut an die Besiedlung terrestrischer Lebensräume angepasst?

    Lösung

    Die gelenkig gegliederten Extremitäten und das starre Exoskelett ermöglichen den Arthropoden eine schreitende Fortbewegung an Land. Außerdem schützt das Exoskelett vor Austrocknung, was in terrestrischen Lebensräumen unabdingbar ist.
  • Wie gelingt es Plattwürmern, ohne Atemorgane und Kreislaufsystem zu überleben?

    Lösung

    Durch den dorsoventral abgeflachten Körper der Plattwürmer (Plathelminthes) befinden sich sämtliche Zellen nahe der Körperoberfläche und ermöglichen einen direkten Gasaustausch über die Oberfläche. Zudem erhöht der stark verzweigte Darm die Fläche, über die Nährstoffe in die Körperzellen gelangen können.
  • Warum sind die meisten Ringelwürmer auf feuchte Lebensräume beschränkt?

    Lösung

    Die meisten Ringelwürmer (Anneliden) zeichnen sich durch eine dünne, durchlässige Körperwand aus, durch deren Oberfläche der Gasaustausch erfolgt. Über diese Körperwand erleiden Ringelwürmer aber auch einen raschen Wasserverlust, wenn man sie ihrer aquatischen oder feuchten Umgebung entnimmt.
  • Bei den Mollusken hat sich eine Fülle verschiedener Baupläne entwickelt. Erläutern Sie anhand einiger Beispiele, wie die grundlegende Organisation des Molluskenbauplans abgewandelt wurde und so diese Vielfalt zustande kam.

    Lösung

    Der Grundbauplan der Mollusken umfasst einen muskulösen Fuß, einen Eingeweidesack und einen Mantel, der in den meisten Fällen eine harte, kalkhaltige Schale abscheidet. Viele Mollusken haben zudem einen Kopf. Die Modifikationen bei den einzelnen Großgruppen der Mollusken betreffen in erster Linie den Fuß und die Schale. Der Fuß wurde im Laufe der Evolution so abgewandelt, dass er zum Kriechen (bei den Schnecken), zum Graben (bei den Muscheln), zum Anheften (bei den Käferschnecken) oder zur Nahrungsaufnahme und Sinneswahrnehmung (wie bei den Armen und Tentakeln der Kopffüßer) dient. Die Schale erfuhr ebenfalls unterschiedliche Abwandlungen: zu einer Reihe flexibler, schützender Platten (bei den Käferschnecken), einer zweiklappigen, durch ein Gelenk verbundenen Schale (bei den Muscheln), zu einer stark reduzierten inneren Stützstruktur (bei vielen Kopffüßern) oder zu einem mobilen, oft spiraligen Gehäuse als Schutz für den Eingeweidesack (bei den Schnecken).
  • Inwelcher Hinsicht und warum unterscheidet sich die Dicke der Cuticula bei verschiedenen Vertretern der Ecdysozoa?

    Lösung

    Die Cuticula vieler wurmförmiger Ecdysozoa ist relativ dünn und flexibel. Daher erfüllt sie kaum eine schützende und stützende Funktion für den Körper, ermöglicht aber den Austausch von Wasser, Gasen und Mineralstoffen über die Körperoberfläche. Arten mit dünner Cuticula sind gewöhnlich auf aquatische oder feuchte Lebensräume beschränkt. Im Gegensatz dazu besitzen die meisten Arthropoden (Gliederfüßer) eine dicke, recht starre Cuticula und damit einen guten Schutz vor Austrocknung und Feinden. An dieser Cuticula können auch die Muskeln ansetzen. All dies ermöglicht den Gliederfüßern auch die Besiedlung trockener Lebensräume.
  • Beschreiben Sie mindestens drei Möglichkeiten, wie Nematoden einen bedeutenden Einfluss auf den Menschen haben.

    Lösung

    Nematoden haben eine dicke Cuticula. Viele ernähren sich von totem organischem Material im Boden und spielen eine wichtige Rolle für die Zersetzung und Bodenbildung (die auch für die Landwirtschaft von Bedeutung ist). Der Nematode Caenorhabditis elegans ist ein bedeutender Modellorganismus und wird vielfach für entwicklungsgenetische Forschungen eingesetzt. Andere Nematodenarten sind Parasiten des Menschen und verursachen Krankheiten wie Trichinose oder Elephantiasis.
  • Welche Merkmale oder Eigenschaften haben dazu beigetragen, dass die Arthropoden heute zu den arten- wie auch individuenreichsten Tiergruppen der Erde zählen?

    Lösung

    Der segmentierte Körper mit dem starren Exoskelett und den gelenkigen Körperanhängen (Extremitäten) verschaffte den Arthropoden Stabilität und ermöglichte ihnen unterschiedliche Fortbewegungsweisen (Schreiten, Schwimmen, Fliegen). Dadurch konnten sie sich viele verschiedene Lebensräume erschließen. Außerdem bot ihnen das Außenskelett Schutz vor Austrocknung und Feinden.
  • Erläutern Sie den Unterschied zwischen unvollständiger und vollständiger Metamorphose (Hemi- und Holometabolie).

    Lösung

    Bei einer unvollständigen Metamorphose (Hemimetabolie) erfolgt eine Reihe gradueller Veränderungen zwischen den Larvenstadien. Diese ähneln im Aussehen den adulten Formen. Dagegen kommt es bei einer vollständigen Metamorphose (Holometabolie) zu einem umfangreichen morphologischen Wandel zwischen den Entwicklungsstadien, etwa bei den Raupen und Puppen von Schmetterlingen.
  • Bislang wurden weltweit mehr Insektenarten beschrieben und benannt als Arten aller anderen Tiergruppen zusammen. Allerdings besiedeln nur sehr wenige Insektenarten marine Lebensräume und sind dort auf die Gezeitenzone oder die Meeresoberfläche beschränkt. Welche Faktoren könnten dazu beigetragen haben, dass den Insekten in den Meeren so wenig Erfolg beschieden war?

    Lösung

    Einer der Faktoren, der zum Erfolg der Insekten beigetragen hat, war ihr besserer Zugang zu Pflanzen durch das Flugvermögen. Viele Insektenarten haben sich auf einige oder wenige Pflanzenarten spezialisiert, und an Land und im Süßwasser ist die Artenvielfalt der Pflanzen weitaus höher als in den Meeren. Zwar verbringen manche Insekten einen Teil ihres Entwicklungszyklus oder sogar das ganze Leben im Süßwasser, aber diese limnischen Lebensräume sind eng mit den umgebenden terrestrischen Habitaten assoziiert. Um als Landtier das Meer zu besiedeln, müssen Mechanismen entwickelt werden, um mit dem hohen Salzgehalt fertig zu werden. Das ist den Insekten offenbar nicht gelungen. Die Krebstiere (Crustaceen) waren in den Meeren schon vor der Evolution der Insekten mit sehr vielen gut angepassten Arten verbreitet und bedeuteten deshalb in marinen Lebensräumen vielleicht eine zu starke Konkurrenz.
  • Welche drei Entwicklungsmuster haben alle Deuterostomier gemeinsam?

    Lösung

    Deuterostomier sind durch folgende Entwicklungsmuster gekennzeichnet: eine Radiärfurchung; aus dem Urmund (Blastoporus) entwickelt sich der After (der Mund entsteht am gegenüberliegenden Ende des Urdarms); das Coelom entsteht aus Aussackungen des Urdarms. Die Radiärfurchung ist jedoch kein spezielles Alleinstellungsmerkmal der Deuterostomier, sondern stellt vermutlich den ursprünglichen Zustand bei allen Bilateria dar, denn man findet sie auch bei einigen Protostomiern. Die Entwicklung des Urmunds zum After ist dagegen auf die Deuterostomier beschränkt, könnte aber ebenfalls den ursprünglichen Zustand aller Bilateria repräsentieren.
  • Durch welche Belege wird die Monophylie der Deuterostomier ganz besonders gestützt?

    Lösung

    Vergleiche von DNA-Sequenzen vieler verschiedener Gene liefern die überzeugendsten Belege dafür, dass die Deuterostomier eine monophyletische Gruppe bilden.
  • Welche drei Großgruppen umfassen die Deuterostomier? Ordnen Sie die folgenden Beispiele jeweils der entsprechenden Gruppe zu: Mensch, Eichelwurm, Klapperschlange, Thunfisch, Seestern.

    Lösung

    Die drei Großgruppen der Deuterostomier sind die Stachelhäuter (Echinodermata), die Kiemenlochtiere (Hemichordata) und die Chordatiere (Chordata). Seesterne sind Stachelhäuter, Eichelwürmer zählen zu den Hemichordaten, der Mensch, die Klapperschlange und der Thunfisch sind Chordaten.
  • Inwiefern unterscheidet sich der Körperbau der Larven von Stachelhäutern von dem adulter Tiere?

    Lösung

    Die Larven von Stachelhäutern sind bilateralsymmetrisch, die adulten Tiere hingegen fünfstrahlig radiärsymmetrisch.
  • Beschreiben Sie einige der Möglichkeiten, wie Echinodermen ihre Ambulacralfüßchen zum Erlangen von Nahrung einsetzen, und stellen sie diese den Mechanismen des Nahrungserwerbs bei Hemichordaten gegenüber.

    Lösung

    Seelilien und Haarsterne filtrieren mit ihren schleimüberzogenen Ambulacralfüßchen Nahrungspartikel wie Phytoplankton aus dem vorbeiströmenden Wasser. Seeigel weiden Aufwuchs ab. Seegurken besitzen spezielle, zu großen, klebrigen Tentakeln modifizierte Ambulacralfüßchen, die sie zum Fang ihrer Nahrung aus dem Mund vorstrecken können; bleibt Nahrung daran kleben, ziehen sie die Tentakel wieder zurück und befördern die Nahrung in den Verdauungstrakt. Viele Seesterne packen mithilfe ihrer Ambulacralfüßchen Muscheln, öffnen damit deren Klappen und fressen sie leer. Einige von ihnen stülpen dazu den oralen Teil ihres Magens hervor und verdauen so das Innere der Muschel. Die Hemichordaten sind wie einige Echinodermen Filtrierer, besitzen aber keine Ambulacralfüßchen. Stattdessen fangen sie ihre Nahrung mit ihrem von Schleim überzogenen Proboscis und transportieren die schleimumhüllten Nahrungspartikel dann durch Cilienschlag in den Mund.
  • Beschreiben Sie die kennzeichnenden gemeinsamen abgeleiteten Merkmale (Synapomorphien) der Chordaten bzw. der Wirbeltiere.

    Lösung

    Die Chordaten sind durch ein dorsales Neuralrohr, einen postanalen Schwanz und eine Chorda dorsalis charakterisiert; hinzu kommt noch ein Kiemendarm als ursprüngliches Merkmal. Wirbeltiere besitzen einen Kopf mit einer Schädelkapsel, die ein großes Gehirn umgibt, ein Endoskelett mit der Wirbelsäule als Verankerung, innere Organe, die in einem Coelom (sekundäre Leibeshöhle) aufgehängt sind, sowie ein gut entwickeltes, geschlossenes Kreislaufsystem mit einem ventral gelegenen Herzen als Antrieb.
  • Welche Unterschiede bestehen zwischen Ingern (Schleimaalen) und Neunaugen hinsichtlich ihrer Morphologie? Warum betrachten manche Biologen die Inger nicht als Wirbeltiere?

    Lösung

    Bei den Ingern oder Schleimaalen ist das Kreislaufsystem nur sehr schwach ausgeprägt, mit drei akzessorischen (statt einem einzelnen großen) Herzen. Ihre Schädelkapsel ist nur teilweise ausgebildet und auch ihr Gehirn ist einfacher gebaut als das anderer Wirbeltiere. Im Skelett finden sich keine einzelnen, gelenkig verbundenen Wirbel. Weil den Ingern solche grundlegenden Merkmale fehlen, die alle anderen Wirbeltiere auszeichnen, werden sie von einigen Biologen nicht als Vertebraten, sondern als deren Schwestergruppe betrachtet. Andererseits könnten diese Merkmale bei den Ingern auch sekundär verloren gegangen bzw. vereinfacht worden sein.
  • Der Körperbauplan der meisten Wirbeltiere basiert auf vier Extremitäten. Welche unterschiedlichen Formen haben diese Körperanhänge angenommen und wie werden sie eingesetzt? In welchen Linien gingen zwei oder mehr dieser Extremitäten gänzlich verloren?

    Lösung

    Die vier Extremitäten, die den meisten Wirbeltieren gemeinsam sind, sind jeweils paarige Anhänge am Schultergürtel und am Becken. Bei den meisten schwimmenden Wirbeltieren fungieren diese Extremitäten als Flossen. Gewöhnlich dienen sie dem Antrieb (besonders die Brustflossen), aber auch der Steuerung, Stabilisierung und der Koordination der Körperposition im Wasser. Bei den Tetrapoden (Landwirbeltiere) sind die Anhänge oftmals zu Gliedmaßen modifiziert und dienen dem Gehen, Laufen, Springen, Graben, Klettern, Greifen sowie der Manipulation von Objekten. Bei aquatischen Tetrapoden haben sich die Extremitäten mehrere Male sekundär wieder zu flossenähnlichen Gliedmaßen entwickelt (etwa innerhalb der Amphibien, der Schildkröten, Vögel und Säugetiere). Zu Flügeln für ein aktives Fliegen wurden die Vorderextremitäten bei mindestens drei Linien der Tetrapoden (bei den Vögeln, den Fledermäusen und den Flugsauriern) modifiziert. Bei anderen ermöglichen die Abwandlungen einen Gleitflug (darunter Fische, Amphibien, Echsen und Säugetiere). Bei manchen Gruppen der Fische, Amphibien, Sauropsiden (Reptilien einschließlich der Vögel) und Säugetiere wurden ein oder auch beide paarige Extremitäten stark reduziert oder gingen ganz verloren. Zu den bekanntesten Beispielen für eine Reduktion der Gliedmaßen zählen die völlig beinlosen Blindwühlen und Schlangen; bei den Walen und Seekühen sind die Hinterextremitäten so stark reduziert, dass sie von außen nicht sichtbar sind; bei einigen flugunfähigen Vögeln haben die Flügel eine erhebliche Reduktion erfahren.
  • Amphibien haben schon seit Millionen von Jahren erfolgreich überlebt, aber heute verschwinden viele Arten ganz und die Populationen anderer gehen bedenklich zurück. Welche Merkmale ihres Entwicklungszyklus könnten Amphibien besonders anfällig für Umweltveränderungen machen, wie sie gerade auf der Erde stattfinden?

    Lösung

    Da Amphibien über ihre sehr durchlässige Haut Atemgase und Wasser austauschen, reagieren sie äußerst empfindlich auf viele Umweltgifte und manche Krankheitserreger (insbesondere einen eingeschleppten Flagellatenpilz). Aufgrund ihres zweiphasigen Entwicklungszyklus sind viele Amphibienarten besonders anfällig für die Zerstörung von Habitaten und den Verlust von aquatischen und terrestrischen Lebensräumen. Weil die meisten Amphibien keine großen Strecken zurücklegen, gelingt es ihnen nicht so leicht, nach Zerstörung ihres lokalen Habitats in ein neues abzuwandern. Aus diesen Gründen reagieren sie auch empfindlich auf rasche Klimaänderungen. Viele Amphibienarten stellen äußerst spezielle Ansprüche an ihr Habitat und haben ein sehr eingeschränktes Verbreitungsgebiet. Daher führen Habitatverluste oder Veränderungen innerhalb dieser Verbreitungsgebiete häufig zum Aussterben.
  • Inwiefern haben sich Massenaussterben und die Kontinentalverschiebung auf die Diversifizierung der Säugetiere ausgewirkt?

    Lösung

    Nach dem Massenaussterben an der Grenze von der Kreide zum Tertiär durchliefen die großen Säugetierlinien eine rasche Diversifizierung. Diese Gelegenheiten zur Radiation ergaben sich vermutlich durch das Aussterben der Dinosaurier. Zu jener Zeit hatten sich die großen Kontinente durch die Kontinentalverschiebung aufgetrennt, sodass in Laurasia, Afrika, Südamerika, Europa und Südostasien eigene Radiationen von Säugetieren erfolgen konnten.
  • Es ist noch gar nicht so lange her, dass der Auffassung, Vögel könnten von den Dinosauriern abstammen, mit großer Skepsis begegnet wurde. Erklären Sie, inwiefern Fossilbelege, morphologische Merkmale und molekulare Daten mittlerweile die Herkunft der Vögel von Dinosauriern stützen.

    Lösung

    Wie Fossilfunde theropoder Dinosaurier zeigen, haben sich zahlreiche Merkmale, die einst als auf Vögel beschränkt galten wie Federn, in Wirklichkeit bereits viel früher bei den Theropoden entwickelt. Andere für Vögel typische morphologische Merkmale wie hohle Knochen und eine Furcula (Gabelbein) sind für die größere Gruppe der Theropoden ebenso kennzeichnend. DNA-Sequenz-Analysen zufolge gehören die Vögel eindeutig zusammen mit den Krokodilen in ein Monophylum, das die anderen rezenten Reptilien ausschließt. Mittlerweile gibt es eine große Zahl von Belegen aus unterschiedlichsten Quellen, die zusammen dafür sprechen, dass es sich bei den Vögeln um eine rezente Gruppe theropoder Dinosaurier handelt.
  • Betrachten Sie die Phylogenie der Amnioten sowie die Evolution von Endothermie, Haaren und Federn. Welches dieser Merkmale hat sich wahrscheinlich in mehr als einer Linie konvergent entwickelt? Welcher funktionelle Zusammenhang besteht vermutlich zwischen diesen Merkmalen? Warum sind viele Paläontologen der Ansicht, dass mehrere ausgestorbene Vertreter der Theropoden endotherm waren?

    Lösung

    Haare evolvierten beim Vorfahren der Säugetiere, Federn bei den theropoden Dinosauriern (wie heute an den Vögeln zu erkennen). Von den rezenten Tetrapoden sind die Vögel und die Säugetiere endotherm. Haare und Federn dienen den Säugetieren bzw. Vögeln zur Isolierung des Körpers. Ohne eine derartige Isolierung wäre es schwierig, die Körpertemperatur durch erzeugte Stoffwechselwärme aufrechtzuerhalten. Wie Fossilbelege zeigen, besaßen auch schon viele ausgestorbene theropode Dinosaurier Federn. Daher schlossen sich viele Paläontologen der Hypothese an, dass diese Tiere ebenfalls endotherm waren. Von großen, aktiven Räubern würde man ebenfalls erwarten, dass sie endotherm sind – und diese Beschreibung passt zu unserem gegenwärtigen Bild vieler theropoder Dinosaurier.
  • Erläutern Sie die Unterschiede zwischen Altwelt- und Neuweltaffen.

    Lösung

    Neuwelt- oder Breitnasenaffen leben ausschließlich arboreal, die meisten besitzen einen langen Greifschwanz, den sie beim Klettern als fünfte Extremität zum Festhalten einsetzen können. Viele Altwelt- oder Schmalnasenaffen leben überwiegend auf dem Boden, keine der Arten weist einen Greifschwanz auf.
  • Erläutern Sie, wie beim modernen Menschen durch Neotenie ein relativ großes Gehirn und ein relativ kleiner Kiefer entstanden.

    Lösung

    Veränderungen in einem regulatorischen Gen, das die Schädelentwicklung beeinflusst, resultierten möglicherweise beim Menschen in einer verzögerten körperlichen Entwicklung (Neotenie), aber ohne das Größenwachstum zu behindern. Dies führte in der Evolution dazu, dass die Schädelform bei Erwachsenen recht ähnlich der juvenilen Schädelform ist (mit einem relativ großen Gehirn und kleinem Kiefer). Der menschliche Schädel nahm also an Größe zu, ohne dabei seine Form so stark zu verändern wie bei unseren nächsten Verwandten, den Schimpansen.
  • Wie erschließen sich Pflanzen die Ressourcen ihrer Umwelt, obwohl sie sich nicht fortbewegen können?

    Lösung

    Aufgrund des Baus ihrer Organe wie Blätter und Wurzeln können Pflanzen ausreichend Wasser, Mineralstoffe und CO2 aufnehmen. Außerdem vermögen Pflanzen zeitlebens zu wachsen und sind somit in der Lage, auf ihre Umwelt angepasst zu reagieren. Beispielsweise kann eine Pflanze ihre Wuchsrichtung ändern und so Ressourcen in ihrer unmittelbaren Umgebung besser nutzen.
  • Beschreiben Sie die wesentlichen Unterschiede in der Entwicklung von Pflanzen und Tieren.

    Lösung

    Pflanzen wachsen ein Leben lang; hingegen stellen Tiere nach Erreichen des Adultstadiums häufig ihr Wachstum ein. Pflanzenzellen sind totipotent; bei Tieren zeichnen sich lediglich die Zygote und teilweise noch die frühesten embryonalen Zellen durch Totipotenz aus. Bei Pflanzenzellen erfolgt im Verlauf der Cytokinese eine ungleiche Teilung, die zu einer Orientierung bei der Entwicklung der Organe führt; an der Entwicklung von Tieren ist auffällig, dass die Zellen Ortsveränderungen vornehmen.
  • Erläutern Sie, wie es zur Entwicklung der apikal-basalen und der radialen Achse kommt.

    Lösung

    Die apikal-basale Achse entwickelt sich bei Pflanzen durch eine ungleiche Zellteilung, die zu unterschiedlichen Tochterzellen im frühen Embryo führt: Aus den Apikalzellen geht später die Spitze (der Apex) der Pflanze hervor, aus den Basalzellen die Basis. Die radiale Achse entsteht durch Zelldifferenzierung; hierbei ist der Embryo zunächst rundlich, später dann zylindrisch geformt.
  • In einer Mutantenlinie von Arabidopsis tritt im Embryo keine apikal-basale Polarität auf. Wodurch wird Ihrer Ansicht nach das phänotypische Erscheinungsbild der ausgewachsenen Pflanzen charakterisiert sein?

    Lösung

    Ohne eine apikal-basale Polarität wird sich nur ein massiver, rundlicher Embryo entwickeln, und es werden keine Spross- und Wurzelspitzen mit den entsprechenden Meristemen entstehen. Damit könnten sich Wurzeln und Spross – wenn überhaupt – an beliebigen Stellen der sich entwickelnden Pflanze bilden.
  • Erstellen Sie eine Tabelle, in der Sie die drei Typen von Grundgewebe hinsichtlich ihrer Struktur und Funktion einander gegenüberstellen.

    Lösung

  • Aufgrund welcher Strukturunterschiede sind Gewebe aus Kollenchymzellen biegsamer als solche, die vorwiegend aus Sklerenchymzellen bestehen?

    Lösung

    Bei Kollenchymzellen werden die Ecken der Zellwände von Primärwänden gebildet, daher ist das Gewebe einigermaßen flexibel. Sklerenchymzellen zeichnen sich durch dickere, weniger flexible Sekundärwände aus.
  • Beschreiben Sie die Unterschiede zwischen Tracheiden und Tracheengliedern (Gefäßelementen).

    Lösung

    Nach dem Absterben der Tracheiden durch Apoptose verbleiben in den Zellwänden Tüpfel, die einen Wasserdurchfluss durch die Zellen ermöglichen. Tracheenglieder (Gefäßelemente) sind, mit den Enden aneinandergrenzend, hintereinander zu langen Röhrenangeordnet, die nach dem Absterben der Zellen eine durchgehende Leitungsbahn bilden.
  • Wie kann ein Apikalmeristem jahrelang erhalten bleiben und weiterhin fortlaufend Blätter bilden?

    Lösung

    Ein Apikalmeristem enthält Zellen, die sich kontinuierlich teilen. Einige der entstehenden Tochterzellen bilden neue Pflanzenorgane (z.B. Blätter), andere verbleiben im Pool undifferenzierter Zellen, die sich weiterhin teilen.
  • Nennen Sie die primären Meristeme einer Pflanze, und erläutern Sie, welche Gewebe und Organe jeweils daraus hervorgehen.

    Lösung

    Aus dem Wurzel- und Sprossapikalmeristem gehen die Primäremeristeme hervor, die für das primäre Wachstum von Pflanzen verantwortlich sind und alle pflanzlichen Gewebe bilden. Man unterscheidet drei Primärmeristeme: 1. Aus dem Protoderm entsteht das Abschlussgewebe, 2. aus dem Grundmeristem das Grundgewebe und 3. aus dem Prokambium das Leitgewebe.
  • Welche Zellen leiten sich vom Wurzelapikalmeristem ab, und wie läuft das Wurzelwachstum generell ab?

    Lösung

    Das Wurzelapikalmeristem bildet die Wurzelhaube (Calyptra) und das primäre Wurzelmeristem. Aus Letzterem gehen das Abschluss-, das Grund- und das Leitgewebe der Wurzel hervor. Das Wachstum der Wurzel erfolgt durch Zellstreckung in einer Zone unmittelbar oberhalb des Wurzelapikalmeristems.
  • Nennen Sie die Unterschiede zwischen primärem Wachstum und sekundärem Dickenwachstum eines Baumstamms hinsichtlich der jeweils daran beteiligten Meristeme, der gebildeten Gewebe und des dadurch erfolgenden Wachstums.

    Lösung

    Die beteiligten Meristeme sind beim primären Wachstum das Apikalmeristem, beim sekundären Dickenwachstum das Lateralmeristem (Kambium) und das Lateralmeristem (Korkkambium).
    Die gebildeten Gewebe sind: beim primären Wachstum Xylem, Phloem, Parenchym, Abschlussgewebe, beim sekundären Dickenwachstum sekundäres Xylem und Phloem, Kork.
    Die Form des Wachstums ist beim primären Wachstum das Längenwachstum, beim sekundären Dickenwachstum die Zunahme des Umfangs.
  • Warum sind Samen von wilden Verwandten der Kulturpflanzen so wertvoll?

    Lösung

    Die Samen der wilden Verwandten von Kulturpflanzen enthalten noch Gene, die im Laufe der Züchtung der Kultursorten ausgelesen wurden. Vielleicht codieren diese Gene einen Phänotyp, der bestens an die natürliche Umgebung dieser Pflanzen angepasst war, der den Züchtern früher jedoch nicht nutzbringend erschien. Aber die Umweltbedingungen können sich ändern, und so können auch Gene, die einst ausgelesen wurden, wieder wertvoll werden. Ein Beispiel hierfür wäre eine Klimaänderung, durch die tief wurzelnde Pflanzen im Vorteil sind. Der kultivierten Pflanze fehlen die Gene für diesen Phänotyp vielleicht, aber bei einer wilden Verwandten könnten entsprechende Gene für das Wurzelwachstum möglicherweise noch vorhanden sein.
  • Welche Rolle spielt die Zellwand hinsichtlich der Bewegungsrichtung des Wassers und der Gestalt von Pflanzen?

    Lösung

    Pflanzenzellen schwellen an, wenn sie Wasser aufnehmen. Die Zellwand bietet einen Widerstand gegen das Anschwellen und sorgt dafür, dass der Druck innerhalb der Zelle zunimmt. Dies führt zu einer starreren Form der Pflanzenorgane und verringert zudem die Tendenz der Pflanzenzellen, noch mehr Wasser aufzunehmen.
  • Ein wesentlicher Bestandteil des Wurzelwachstums bildet die osmotisch gesteuerte Zellstreckung, bewerkstelligt durch die Bildung und das Anschwellen der Zentralvakuole. Welche Funktion kommt Ihrer Ansicht nach der Expression von Aquaporinen bei dieser Zellstreckung zu?

    Lösung

    Aquaporine sind Proteine, die Membrankanäle bilden und dadurch den Durchtritt von Wasser durch Osmose erleichtern. Sie kommen sowohl in der Plasmamembran als auch in der Membran der Vakuole vor. Ob und in welcher Zahl Aquaporine vorhanden sind, wirkt sich auf die Rate der Wasserbewegung durch die Membran von einem Bereich mit höherem Wasserpotenzial in einen mit geringerem Wasserpotenzial aus. Während der Zellstreckung würde man eine erhöhte Expression von Aquaporinen in der Vakuolenmembran erwarten, um eine vermehrte Aufnahme von Wasser und einen höheren Turgordruck zu ermöglichen.
  • Welche Unterschiede bestehen zwischen dem Apoplasten und dem Symplasten?

    Lösung

    Der Apoplast befindet sich außerhalb der Plasmamembran und besteht aus den Zellwänden und den Interzellularräumen. Er bildet damit ein zusammenhängendes Kompartiment. Den Symplasten bildet das Cytoplasma der Zellen; sofern die Zellen über Plasmodesmen in Verbindung stehen, kann der Symplast ebenfalls als ein kontinuierliches Kompartiment betrachtet werden. Durch den Apoplasten erfolgt die Wasserbewegung schnell, durch den Symplasten langsamer.
  • Mit welchem Experiment wurde die Hypothese widerlegt, dass von den Wurzeln ausgehender Druck eine Rolle für die Aufwärtsbewegung von Wasser im Xylem spielt?

    Lösung

    Ein Baum wurde nahe der Basis abgesägt und anschließend in eine Giftlösung gestellt. Das Gift stieg im Stamm auf und tötete auf seinem Weg sämtliche Zellen ab – ein Hinweis darauf, dass die Flüssigkeit zum Aufsteigen nicht die Wurzel benötigt.
  • Die folgende Tabelle zeigt Messungen des Wasserpotenzials (Ψ) in einem 100 m hohen Baum und seiner Umgebung:Die Schwerkraft übt pro Meter Höhe über dem Boden eine Kraft von –0,01 MPa aus.

    a. Ist das Wasserpotenzial im Blatt niedrig genug, um das Wasser bis in die Baumwipfel zu ziehen?
    b. Würde weiterhin eine Transpiration erfolgen, wenn das Wasserpotenzial im Boden auf –0,1 MPa fiele?
    c. Was wird Ihrer Ansicht nach mit dem Wasserpotenzial im Xylem passieren, wenn alle Spaltöffnungen geschlossen sind?

    Lösung

    a. Ja. Der Unterschied im Wasserpotenzial zwischen dem Boden und dem Blatt (1,7 MPa) reicht aus, um die Schwerkraft zu überwinden und das Wasser bis in die Baumwipfel aufwärtszuziehen.
    b. Nein. Wenn das Bodenwasserpotenzial auf –1,0 MPa fiele, so wäre es negativer als innerhalb der Wurzelzellen, und Wasser würde aus den Wurzeln in den Boden austreten.
    c. Wenn alle Spaltöffnungen geschlossen wären, wäre das Wasserpotenzial im Blatt nicht so negativ. Das würde wiederum das Wasserpotenzial im Xylem negativer machen usw. bis hinunter in die Wurzeln. Dadurch wäre der Unterschied zwischen dem Wasserpotenzial im Blatt und jenem in der Wurzel nicht ausreichend, um einen Wasserfluss von den Wurzeln zu den Blättern (in Richtung eines negativeren Wasserpotenzials) zu bewirken.
  • Erläutern Sie, warum alle drei Bestandteile des Transpirations-Kohäsions-Saugspannungs-Mechanismus für den Transport von Wasser durch das Xylem erforderlich sind.

    Lösung

    Durch Transpiration verdunstet Wasser aus den Zellwänden in den Blättern. Das muss erfolgen, denn dadurch startet dieser Prozess. Der aus der Transpiration resultierende Anstieg des negativen Druckpotenzials zieht mehr Wasser in die Zellwände hinein und beginnt, eine Saugspannung (den zweiten Teil des Prozesses) auf die gesamte Wassersäule im Xylem auszuüben. Die Kohäsion sorgt für den Zusammenhalt der Wassermoleküle, sodass diese quasi aneinander „kleben". Sie verhindert, dass die Wassersäule abreißt und damit Spannung verloren geht und die Säule nicht weiter aufsteigt.
  • Welche Belege stützen den Transpirations-Kohäsions-Saugspannungs-Mechanismus für den Wassertransport durch das Xylem?

    Lösung

    Der große Unterschied der Wasserpotenziale von Boden und Luft reicht aus, um Wasser durch das Xylem aufwärtszuziehen, wenn Wasser an die Luft verdunstet. Dies ist ein Beleg für die Transpiration. Die kontinuierliche, durch das Xylem aufsteigende Wassersäule stellt einen Beleg für die Kohäsion dar. Abgesägte Stämme zeigen ein hohes negatives Druckpotenzial und belegen damit, dass das Xylem unter beträchtlicher Saugspannung steht.
  • Welche Rolle spielen K+-Ionen bei der Funktion der Schließzellen?

    Lösung

    Bei Sonnenlicht pumpt eine Protonenpumpe in der Zellmembran der Schließzellen Protonen (H+) aus den Zellen heraus. Dadurch entsteht ein elektrochemischer Gradient über der Zellmembran der Schließzellen, und K+-Ionen treten in die Zellen ein. Hierdurch ergibt sich wiederum ein osmotischer Gradient, sodass Wasser in die Schließzellen eindringt. Dadurch werden diese turgeszent, verändern ihre Form, und zwischen zwei benachbarten Schließzellen öffnet sich ein Porus. Die Spaltöffnung ist nun geöffnet. Bei Dunkelheit ist die Protonenpumpe weniger aktiv, K+ diffundiert passiv aus der Zelle heraus, und die Stomata schließen sich.
  • Beschreiben Sie, wie sich die Verfügbarkeit von Wasser auf die Funktion der Stomata auswirken kann.

    Lösung

    An heißen, trockenen Tagen verlieren die Mesophyllzellen Wasser, was zu einem Schließen der Spaltöffnungen führt. An kühleren, feuchteren Tagen bleiben die Stomata geöffnet.
  • Erklären Sie den Unterschied zwischeneiner Quelle (Source) und einer Senke (Sink).

    Lösung

    Als Quelle oder Source bezeichnet man ein Organ, das mehr lösliche Kohlenhydrate produziert, als es benötigt. Das können Orte der Photosynthese sein (z.B. Blätter) oder Speicherorgane für Stärke (z.B. Samen). Unter einer Senke oder Sink versteht man ein Organ, dass nicht genügend Kohlenhydrate produziert, um den eigenen Bedarf zu decken, und diese daher von einer Quelle (Source) erhalten muss. Beispiele für solche Senken sind unter anderem Wurzeln und Blüten.
  • Auf welche Weise führt die Beladung mit Saccharose am Bildungsort (Source) zu einem Massenstrom hin zum Verbrauchsort (Sink)?

    Lösung

    Source-Zellen beladen die Siebröhren des Phloems mit Saccharose, wodurch sich deren Wasserpotenzial verringert. Dadurch tritt Wasser von benachbarten Xylemgefäßen in die Siebröhren ein und erhöht dort den hydrostatischen Druck, was den Saftfluss antreibt. In einem Sink-Organ wird die Saccharose wieder entladen, einhergehend mit einer Zunahme des Wasserpotenzials in der Siebröhre. Deshalb strömt Wasser wieder ins Xylem zurück. Eine Kombination dieser beiden Vorgänge bewirkt den Druckstrom.
  • Bereits vor etwa 150 Jahren wurden Methoden entwickelt, mit denen sich feststellen lässt, ob ein bestimmtes Element für das Wachstum von Pflanzen essenziell ist. Warum hat man bei einigen Elementen trotzdem erst in jüngerer Zeit festgestellt, dass sie essenziell sind?

    Lösung

    Weil Lösungen, die man als rein betrachtete, in Wirklichkeit nicht rein waren. Sie enthielten Spuren von Elementen, die man zum damaligen Zeitpunkt nicht nachweisen konnte. Erst die in neuerer Zeit entwickelten Methoden ermöglichten es, essenzielle Nährelemente nachzuweisen, die man zuvor gar nicht bemerkt hatte.
  • An welchem Nährelementmangelt es vermutlich, wenn die jungen Blätter einer Pflanze gelb gefärbt sind? Und um welchen, wenn die Gelbfärbung die ältesten Blätter betrifft?

    Lösung

    Gelbe Blätter bei einer jungen Pflanze könnten auf einen Mangel an Eisen oder Schwefel zurückgehen; die Gelbfärbung bei älteren Blättern deutet auf ein Stickstoffdefizit hin.
  • Wie steuern Pflanzen die Aufnahme und Assimilation von mineralischen Nährelementen?

    Lösung

    Pflanzen exprimieren spezifische Transportermoleküle, um Nährstoffe aus dem Bodenwasser durch die Plasmamembranen zu transportieren. Je mehr Transportermoleküle produziert werden, desto größere Mengen des entsprechenden Mineralions kann die Pflanze aufnehmen.
  • Inwiefern ist es Pflanzen durch lebenslanges Wachstum möglich, Nährelementezu beziehen?

    Lösung

    Die Wurzeln von Pflanzen können in Richtung von Mineralstoffquellen im Boden wachsen, Sprosse und Blätter können so orientiert werden, dass sie für bestmöglich das Sonnenlicht die Photosynthese einfangen können und der Luft ausgesetzt sind.
  • Böden sind dynamische Systeme. Welche Veränderungen könnten auftreten, wenn eine Ackerfläche, die über viele Jahre hinweg relativ ausgetrocknet war, nun für den Anbau stark bewässert wird? Zu welchen Veränderungen im Boden könnte es kommen, wenn ein Laubwald gerodet wird und auf der Fläche stattdessen Nutzpflanzen angebaut und jährlich geerntet werden?

    Lösung

    Eine starke Bewässerung nach einer längeren Dürreperiode kann dazu führen, dass der Oberboden (der A-Horizont) weggeschwemmt wird. Außerdem können Ionen (insbesondere Anionen) in den Unterboden ausgewaschen werden, sodass den Pflanzenwurzeln weniger Mineralstoffe zur Verfügung stehen. Wenn ein natürlicher Laubwald durch Nutzungsänderung in eine Ackerfläche umgewandelt wird, ändert sich die Zusammensetzung der Lebewesen im Boden, viele mit den Wurzeln von Bäumen assoziierte Organismen werden verschwinden. Auch die Struktur und Beschaffenheit des Bodens werden sich ändern, weil keine Wurzeln mehr vorhanden sind, welche für den Zusammenhalt des Bodens und luftgefüllte Bodenbereiche sorgen. Ebenfalls wandeln wird sich die chemische Zusammensetzung des Bodens, weil die angebauten Nutzpflanzen dem Boden Mineralstoffe entziehen und diese dann bei der Ernte aus dem System entnommen werden.
  • Wie wirkt sich der Prozess des Kationenaustauschs auf die Bodenfruchtbarkeit aus?

    Lösung

    Durch Kationenaustausch werden Ionen, die an Bodenpartikel gebunden sind,in die Bodenlösung freigesetzt. Von dort können sie dann in Pflanzenwurzeln aufgenommen werden.
  • Welche Unterschiede bestehen zwischen organischen und anorganischen Stickstoffdüngern hinsichtlich der Mineralstoffversorgung der Pflanzen?

    Lösung

    Hinsichtlich der Pflanzenversorgung bestehen zwischen organischen und anorganischen Düngern keine Unterschiede; beide werden in der Form von Nitrat (NO3-) in die Pflanzenwurzeln aufgenommen.
  • Was wird in Mykorrhizen zwischen Pflanzen und Pilzen ausgetauscht und was zwischen Leguminosen und Wurzelknöllchenbakterien (Rhizobien)?

    Lösung

    In beiden Fällen versorgen die Pflanzen den anderen Organismus mit Photosyntheseprodukten (Assimilate, z.B. Zucker). Mykorrhizapilze liefern Phosphor, die Bakterien in den Wurzelknöllchen fixieren Stickstoff.
  • Die Biosphäre der Erde, wie wir sie kennen, ist auf die Existenz einiger weniger Arten stickstofffixierender Prokaryoten angewiesen. Was könnte Ihrer Ansicht nach passieren, wenn eine dieser Arten aussterben würde? Und was, wenn alle ganz verschwänden?

    Lösung

    Zahlreiche Arten fixieren Stickstoff. Bei einem Verlust einer dieser Arten könnten sich vielleicht die Populationen anderer Spezies vergrößern und mehr Stickstoff fixieren. Ein Verschwinden sämtlicher stickstofffixierender Arten hätte zur Folge, dass zur Stickstofffixierung nur noch abiotische Methoden (z.B. industrielle Prozesse) verfügbar wären. Damit würde bei einem solchen Verlust die Stickstoffkonzentration in den Böden insgesamt zurückgehen, wodurch auch weniger Stickstoff für das Wachstum von Pflanzen zur Verfügung stünde.
  • Fruchtwechselwirtschaft ist eine verbreitete Anbaumethode; dabei werdenzum Beispiel auf einer Anbaufläche im Wechsel Mais und Sojabohnen angebaut. Erklären Sie im Hinblick auf dieMineralstoffversorgung der angebauten Pflanzen, warum dies praktiziert wird, und berücksichtigen Sie dabei insbesondere die Verfügbarkeit von Stickstoff im Boden.

    Lösung

    Der Anbau von Mais entzieht dem Boden Nitrat. Die Sojabohnen benötigen kein Nitrat, weil sie über stickstofffixierende Wurzelknöllchen verfügen. Wenn man Mais im Wechsel mit Sojabohnen anbaut, wird der aufgebrauchte Stickstoff im Boden wieder durch neuen, von frei lebenden Bodenbakterien fixierten Stickstoff ersetzt.
  • Beschreiben Sie, wie carnivore Pflanzen Nährelementeaus ihrer Beute beziehen. Welches Nährelement erschließen sie sich dadurch hauptsächlich?

    Lösung

    Carnivore Pflanzen fangen Tiere, verdauen deren Proteine und resorbieren die Aminosäuren. Dabei beziehen Sie hauptsächlich das Nährelement Stickstoff.
  • Einige recht strauchartig aussehende Arabidopsis-Mutanten mit stärker verzweigen Sprossen als die Wildtyppflanzen können keine Strigolactone produzieren, denn ihnen fehlt ein Gen, das für die Biosynthese von Strigolactonen erforderlich ist. Als Forscher diesen Pflanzen Strigolactone verabreichten, wuchsen sie normal. Was lässt dieses Experiment über die Funktion der Strigolactone beim Wachstum von Pflanzen schließen? Wie lässt sich dies mit der Erkenntnis vereinbaren, dass Strigolactone bei der Bildung von Arbuskeln und für parasitische Pflanzen als Signalstoffe wirken?

    Lösung

    Das Experiment mit den Arabidopsis-Mutanten lässt darauf schließen, dass diese entweder ihre eigenen oder exogene Strigolactone für die Regulation ihres Wachstums nutzen und über die entsprechenden Rezeptoren und Antwortmechanismen verfügen. Dies bekräftigt die Vorstellung, dass ein ursprünglicher Mechanismus zum Anlocken nützlicher Mikroorganismen auch für die Regulation des Wachstums heutiger Pflanzen genutzt wird. Es könnte aber auch umgekehrt sein: Vielleicht fungierten die Strigolactone ursprünglich als Pflanzenhormon, und die Rolle in der Wechselbeziehung zwischen den Pflanzen und Mikroorganismen hat sich erst später entwickelt.
  • Bei holoparasitischen Pflanzen sind viele der morphologischen und genetischen Merkmale verloren gegangen, die für eine autotrophe Lebensweise erforderlich sind. Wie könnte dies Ihrer Ansicht nach aus evolutionärer Sicht abgelaufensein? (Hinweis: Denken Sie an den Selektionsdruck.)

    Lösung

    Holoparasitische Pflanzen können sich durch die Assoziation mit ihren Wirtspflanzen reduzierten Kohlenstoff erschließen. Daher unterlagen Gene für die Photosynthesefunktionen keinem Selektionsdruck, denn ihr Vorhandensein hätte den Parasiten keinerlei Überlebensvorteile oder bessere Fortpflanzungschancen gebracht. Daher wirkte sich keine Mutation, durch die ein solches Photosynthesegen seine Funktion verlor, nachteilig aus.
  • Unter welchen Bedingungen wäre es für eine Pflanzenart vorteilhaft, wenn ihre Samendormanz durch Feuer unterbrochen wird?

    Lösung

    Bei einem Feuer entsteht Asche, die den Boden mit Mineralstoffen anreichert. Ein Samen, der nach einem Feuer auskeimt, könnte in einem solchen nährstoffreichen Boden begünstigt sein. In Habitaten wie Wäldern, wo von Zeit zu Zeit auf natürliche Weise Feuer entstehen, könnten solche Samen einen Selektionsvorteil haben.
  • Welche Ähnlichkeiten und Unterschiede bestehen zwischen Hormonrezeptoren und Photorezeptoren?

    Lösung

    Hormonrezeptoren und Photorezeptoren sind beides Proteine, die auf ein eintreffendes Signal hin eine strukturelle Veränderung durchlaufen und dadurch in einer Zelle einen Signaltransduktionsprozess in Gang setzen. Bei Photorezeptoren ist dieses Signal ein physikalischer Reiz (Licht), bei Hormonrezeptoren ein chemischer Botenstoff (Hormon).
  • Wie könnte man mithilfe eines genetischen Screenings ein Pflanzengen identifizieren, das an der Dormanz der Samen beteiligt ist?

    Lösung

    Man würde Samen mit einem Mutagen behandeln und dann aussäen. Sofort auskeimende Samen könnten eine Mutation aufweisen, welche die Dormanz betrifft. Diese Mutantenpflanzen könnte man dann mit Wildtyppflanzen vergleichen und die betreffenden Gene isolieren.
  • Zu welchem Resultat würde es bezüglich der Synthese hydrolytischer Enzyme führen, wenn man keimende Gerstenkörner mit einem Inhibitor der mRNA-Translation behandeln würde? Und was käme heraus, wenn man die Samen mit einem Inhibitor der Proteasomfunktion behandelte? Was wäre zu erwarten, wenn man die beiden Inhibitoren auf auxinbehandelten Coleoptilen anwenden würde?

    Lösung

    Ein Inhibitor der Translation würde die von Gibberellinen induzierte Synthese von Hydrolasen blockieren. Ein Proteasominhibitor würde die Hydrolyse des Repressors verhindern, der normalerweise abgebaut wird, wenn Gibberelline auf die Zellen einwirken. Somit wäre die Signaltransduktion von Gibberellin inhibiert, und es würden nicht vermehrt Hydrolasen synthetisiert. Bei den mit Auxin behandelten Coleoptilen würde es ohne Inhibitoren zur Zellstreckung und zum Wachstum der Coleoptilen kommen. Diese Effekte würden in Anwesenheit von Inhibitoren der Translation und des Proteasoms nicht eintreten.
  • Erklären Sie, warum sich die Coleoptilenspitze zum Licht hin krümmt, obwohl Auxin von der lichtzugewandten Seite der Coleoptilenspitze weg wandert.

    Lösung

    In die Zellen auf der lichtabgewandten Seite gelangt mehr Auxin. Durch die Zufuhr an Auxin wird die Zellstreckung auf der lichtabgewandten Seite beschleunigt und so eine Krümmung zum Licht hin bewirkt.
  • Das Bakterium Spiroplasma kunkelii infiziert Maispflanzen und bewirkt bei diesen eine deutliche Verringerung der Wachstumsrate. Infizierte Pflanzen sind zwergwüchsig (Maisstauche). Da sie ähnlich aussehen wie eine genetisch bedingte zwergwüchsige Form von Mais, könnte man vermuten, dass das Bakterium vielleicht die Synthese von Gibberellinen bei den Maispflanzen inhibiert. Beschreiben Sie zwei Experimente, mit denen Sie diese Hypothese überprüfen könnten, von denen aber nur eines eine chemische Messung erfordert.

    Lösung

    Um festzustellen, ob zwischen der Infektion mit Spiroplasma kunkelii und einer vermuteten Inhibition von Gibberellinen ein Zusammenhang besteht, könnten Sie vergleichende Messungen der Gibberellinkonzentration in bakterieninfizierten und normalen Pflanzen durchführen. Eine verringerte Gibberellinkonzentration in den infizierten Pflanzen würde die Hypothese stützen, dass die Spiroplasma-Infektion die Gibberellinsynthese hemmt. Als weitere Möglichkeit könnten Sie normale Pflanzen mit Spiroplasma infizieren und diese dann mit Gibberellinen besprühen. Wenn sich der gestauchte Phänotyp durch diese Behandlung wieder umkehren ließe, könnte man logischerweise schließen, dass die Infektion die verringerte Gibberellinsynthese bedingt.
  • Eine Pflanze zeichnet sich durch eine extrem buschige Wuchsform aus. Wie wird Ihrer Ansicht nach das Auxin/Cytokinin-Verhältnis bei dieser Pflanze sein?

    Lösung

    Cytokinine stimulieren das Auswachsen von Achselknospen zu Zweigen und fördern damit eine buschige Wuchsform. Auxine tragen dazu bei, die Apikaldominanz aufrechtzuerhalten, die eine Verzweigung verhindert. Daher wird die betreffende Pflanze sehr wahrscheinlich ein niedriges Auxin/Cytokinin-Verhältnis aufweisen.
  • In Supermärkten werden zum Frischhalten von Obst Plastiktüten verkauft, die mit gasbindender Aktivkohle imprägniert sind. Wie funktionieren diese?

    Lösung

    Die Aktivkohle der Plastiktüte absorbiert das von reifenden Früchten freigesetzte Ethylen. Dadurch soll ein zu schnelles Reifen und Faulen der Früchte verhindert werden.
  • Eine Pflanze ist durch eine rasche Blattseneszenz gekennzeichnet. Welches Hormon bzw. welche Hormone sind sehr wahrscheinlich in dieser Pflanze aktiv? Und welche sind am ehesten inaktiv?

    Lösung

    Da sowohl Ethylen als auch Brassinosteroide die Seneszenz von Blätternfördern, wird wahrscheinliches eines dieser Hormone aktiv sein oder auch beide. Da Cytokinine die Blattseneszenz verzögern, sind sie in der betreffenden Pflanze vermutlich eher inaktiv.
  • Welche Belege für Blaulichtrezeptoren bei Pflanzen gibt es?

    Lösung

    Wie ein Wirkungsspektrum für die Krümmung von Coleoptilen zum Licht zeigt, ist Blaulicht dafür am effektivsten. Bei genetischen Screenings auf Unempfindlichkeit für Blaulicht hat sich ergeben, dass normale Pflanzen einen Blaulichtrezeptor besitzen, der bei Pflanzen fehlt, welche keine Reaktion auf Blaulicht zeigen.
  • Warum hat Rotlicht andere Auswirkungen auf die Samenkeimung als Dunkelrotlicht?

    Lösung

    Rotlicht bewirkt die Umwandlung des Phytochroms von der Pr- in die Pfr-Form. Die letztere, aktive Form fördert die Samenkeimung. Durch Einwirken von Dunkelrotlicht verringert sich die Menge an der Pfr-Form, weil sie wieder in die bei der Samenkeimung inaktive Pr-Form zurückverwandelt wird.
  • Wie würde es sich auf die Fortpflanzung der Blütenpflanzen auswirken, wenn der Pollenschlauch nicht keimen und normal auswachsen würde?

    Lösung

    Der Pollenschlauch ist erforderlich, damit die Spermazelle von der Narbe der Pflanze zum Kern der Eizelle im Embryosack, der sich im Fruchtknoten am unteren Ende des Griffels befindet, gelangt. Wenn der Pollenschlauch nicht ordnungsgemäß auswächst und den Eizellkern erreicht, bleibt die Fortpflanzung aus; somit werden auch keine Samen und Früchte gebildet.
  • Worin unterscheiden sich die Endprodukte der Meiose bei Megagametophyten und Mikrogametophyten und inwiefern sind diese Unterschiede von Bedeutung für die sexuelle Fortpflanzung?

    Lösung

    Im Megagametophyten (weiblichen Gametophyten) entwickelt sich aus einem der ursprünglichen Kerne die Eizelle, aus den restlichen der Embryosack, der Schutz bietet und der Nährstoffversorgung dient. Im Mikrogametophyten (männlichen Gametophyten) gehen aus den ursprünglich acht Zellen der Meiose vier zweizellige Pollenkörner hervor; jedes davon enthält eine Spermazelle und eine Pollenschlauchzelle, aus welcher der Pollenschlauch auswächst. Der weibliche Gametophyt ist größer und enthält Nährstoffe für den sich entwickelnden Embryo. Pollenkörner sind winzig und zahlreich, was ihre Verbreitung erleichtert und die Wahrscheinlichkeit für eine Bestäubung erhöht.
  • Kernlose Trauben der Sorte Thompson Seedless werden aus triploiden Pflanzen erzeugt. Erklären Sie, warum diese Trauben kernlos sind. Beschreiben Sie, welche Rolle die Blüte bei der Fruchtentwicklung spielt, wenn keine Samen gebildet werden.

    Lösung

    Wenn triploide Zellen eine Meiose durchlaufen, kann es bei der ersten meiotischen Teilung nicht zur homologen Chromosomenpaarung kommen; daher kann die Meiose I nicht normal ablaufen und es werden keine funktionsfähigen Gameten gebildet. Die Frucht wird aus der Wand des Fruchtknotens der Blüte gebildet. Wahrscheinlich werden die kernlosen Weinbeeren durch Stecklinge vermehrt (vegetative Vermehrung).
  • Welchen Selektionsvorteil bringt die Entwicklung vieler unterschiedlicher Fruchttypen mit sich?

    Lösung

    Alle Früchte bieten den Samen Schutz und tragen zu ihrer Verbreitung bei. Aufgrund der großen Vielfalt an Früchten können diese Funktionen auf sehr unterschiedliche Weise erfüllt werden, abhängig vom Standort und den Umweltbedingungen. Manche Samen, wie die vieler Bäume, fallen einfach zu Boden und verbleiben in der Nähe der Elternpflanze. Andere sind viel kleiner und weisen Strukturen auf (wie Flügel oder Widerhaken), die eine Ausbreitung durch den Wind oder Tiere erleichtern. Auf diese Weise können sie weite Entfernungen zurücklegen und so ihr Verbreitungsgebiet ausdehnen, wodurch die Überlebenschancen des Nachwuchses insgesamt erhöht werden.
  • Beschreiben Sie, welche Proteine und Mutationen an den folgenden Beobachtungen beteiligt sind:
    a. Eine Mutantenpflanze blühtohne die normalerweise induzierende Dunkelphase. Wenn man ein Blatt dieser Mutante auf eine nichtexponierte Wildtyppflanze pfropft, bildet die Empfängerpflanze Blüten.
    b. Eine Mutantenpflanze blüht nicht, wenn sie der normalerweise induzierenden Dunkelphase ausgesetzt wird. Wenn man ein Blatt einer Mutante, das der induzierenden Dunkelphase ausgesetzt wurde, auf eine nichtexponierte Wildtyppflanze pfropft, bildet die Empfängerpflanze Blüten.
    c. Eine Pflanze blüht, ohne dass sie zuvor Kälte ausgesetzt war.
    d. Wenn im Blatt ein Gen experimentell überexprimiert wird, erfolgt eine Blühinduktion. Bei einer Überexpression dieses Gens im Sprossapikalmeristem wird jedoch keine Blütenbildung induziert.

    Lösung

    a. Die Mutation führte zu einer Stabilisierung des CO-Proteins.
    b. Die Mutation verursachte einen Funktionsverlust des FD-Proteins.
    c. Die Mutation erhöhte die Expression des FLC-Proteins.
    d. Die Mutation verursachte eine konstitutive Expression des CO-Proteins.
  • Eine Pflanzenzüchterin liefert Schnittblumen für viele Gelegenheiten und benötigt oftmals eine große Zahl von Blumen, die alle gleichzeitig blühen. Viele ihrer Blumen blühen normalerweise im Sommer, sind also Langtagpflanzen. Wie könnte sie es bewerkstelligen, dass diese Pflanzen im Winter blühen?

    Lösung

    Langtagpflanzen blühen normalerweise, wenn die Tage lang und die Nächte kurz sind, wie es im Sommer der Fall ist. Unter Treibhausbedingungen kann man die Pflanzen jedoch austricksen. Indem man mitten in der Nacht für kurze Zeit das Licht anschaltet (nächtliches Störlicht) und die Nacht unterbricht, kann man bewirken, dass die Pflanzen wie auf kurze Nächte reagieren – das heißt, sie beginnen zu blühen.
  • Nennen Sie mindestens zwei Indizien für die Existenz einer übertragbaren Substanz, die von den Blättern in die Apikalmeristeme gelangt und dort die Blütenbildung initiiert.

    Lösung

    Beispiele für Indizien sind unter anderem:
    Spinat blüht nicht, wenn man den Spross abdeckt und dadurch Kurztage simuliert; er blüht hingegen, wenn statt des Sprosses die Knospe abgedeckt wird.
    Wenn man ein photoperiodisch induziertes Blatt sofort von einer Pflanze entfernt, blüht diese nicht. Verbleibt das Blatt jedoch für mehrere Stunden an der Pflanze (sodass die Substanz ausreichend Zeit hat, in die Knospe zu wandern), so bildet diese Blüten.
    Wenn man bei einem Propfexperiment nur bei einer der beiden beteiligten Pflanzen (oder Pflanzenteile) eine Blüte induziert, wird auch die andere Pflanze Blüten bilden.
  • Welche Vor- und Nachteile bringt die vegetative Vermehrung bei Pflanzen mit sich? Worin liegen die Vor- und Nachteile der sexuellen Fortpflanzung?

    Lösung

    Die vegetative Vermehrung erfolgt schnell und gewährleistet, dass die genetischen Anpassungen einer Pflanze erhalten bleiben. Andererseits macht die genetische Homogenität die Nachkommen und Populationen, die auf vegetative Vermehrung zurückgehen, anfällig für Veränderungen der abiotischen oder biotischen Umwelt, weil die Phänotypen der Population alle gleich sind. Durch sexuelle Fortpflanzung entsteht genetische Vielfalt bei den daraus hervorgehenden Nachkommen und Populationen. Aufgrund ihrer vielfältigen Phänotypen kann sich eine solche Population gut an eine sich verändernde Umwelt anpassen. Allerdings verläuft die sexuelle Fortpflanzung langsamer als die vegetative Vermehrung.
  • In welchen Situationen könnte eine vegetative Vermehrung von Pflanzen adaptiv sein?

    Lösung

    Für eine vegetative Vermehrung ist keine Bestäubung erforderlich, sodass rasch zahlreiche neue Pflanzen entstehen können. Viele davon werden durch Ausläufer (Stolonen) oder Rhizome gebildet und sind somit gut an verarmte oder erodierte Böden angepasst, etwa in Hanglagen. Oder sie wachsen als Pionierpflanzen auf instabilen Böden wie Sanddünen. Auch in Halbwüsten und Wüsten ist eine vegetative Vermehrung adaptiv, weil es Keimlinge dort oft schwer haben, sich zu etablieren.
  • Die Identifizierungeiner Mutation im SWII-Gen von Arabidopsis, die zu einer abnormalen Meiose führt, hat Einblicke in den Ablauf der Agamospermie geliefert. Wie würden Sie versuchen, weitere Gene oder Mutationen zu finden, die mit dem Genprodukt von SWII zusammenwirken, wenn Sie uneingeschränkt fruchtbare Pflanzen produzieren möchten, die sich durch Agamospermie fortpflanzen?

    Lösung

    Man könnte dies mittels mehrerer Methoden in Angriff nehmen, beispielsweise durch genetische Screenings auf Zellen in der Meiose, bei denen sich die Chromosomen in der Anaphase I nicht auftrennen, oder durch die Suche nach Proteinen (und deren Genen), die an das SWII-Protein binden.
  • Beschreiben Sie, wie man als Wissenschaftler feststellen könnte, ob eine induzierte Reaktion einer Pflanze eine unspezifische oder eine spezifische Immunantwort darstellt.

    Lösung

    An der unspezifischen und der spezifischen Immunität sind ähnliche Signalwege beteiligt. Für die unspezifische Immunantwort könnte man als Wissenschaftler bei dem Pathogen nach PAMPs suchen und auf eine schwächere Reaktion achten. Für die spezifische Immunantwort könnte die Suche auf eine Gen-für-Gen-Resistenz (Avr-Gene) und programmierten Zelltod sowie die Ausbildung einer nekrotischen Läsion an der Infektionsstelle ausgerichtet sein.
  • Ein Wissenschaftler bringt am Blatt einer gesunden Pflanze einen kleinen Schnitt an, auf den er Salicylsäure appliziert. Welche Reaktion der Pflanze darauf ist zu erwarten?

    Lösung

    Salicylsäure löst eine systemische Resistenz aus. Die Applikation dieser Verbindung auf eine Wunde würde zur Produktion von schützenden PR-Proteinen gegen weitere Infektionen führen, und zwar als lang anhaltender Effekt.
  • Der Milchsaft bestimmter Bäume wird zur Herstellung von Gummi geerntet. Nachdem von einem Bereich des Baumes der Milchsaftgeerntet ist, kann man beobachten, wie Nacktschnecken beginnen, die Blätter in diesem Bereich zu verzehren. Was lässt dies auf die Rolle des Milchsafts für den Baum schließen?

    Lösung

    Das lässt darauf schließen, dass der Milchsaft von Bedeutung für die Abwehr von Herbivoren wie Nacktschnecken ist.
  • Tabakpflanzen produzieren Nicotin als sekundären Pflanzenstoff, die Pflanzen verfügen aber auch über induzierte Abwehrmechanismen gegen Herbivoren. Wie wirken diese Abwehrmethoden zusammen, um die Pflanzen vor Herbivoren zu schützen?

    Lösung

    Weil Nicotin als sekundärer Pflanzenstoff stets in den Tabakblättern vorhanden ist, handelt es sich um eine konstitutive Abwehr, die viele Herbivoren vom Fraß abhält. Induzierte Antworten werden von Herbivoren ausgelöst, die sich von Nicotin nicht beeinflussen lassen.
  • Die Raupen des Heerwurms (Mythimna unipunctata, ein Eulenfalter) ernähren sich unter anderem von den Blättern von Maispflanzen. Die Larven setzen in den Achseln der Blätter an der Sprossachse ihre Exkremente ab. Die dabei freigesetzten Verbindungen signalisieren der Pflanze, dass sie von den Heerwurmraupen angegriffen werden. Daraufhin leitet die Maispflanze eine Abwehr gegen die Raupen ein.
    a. Stellt dies eine Form der konstitutiven oder induzierten Abwehr dar? Erläutern Sie Ihre Antwort.
    b. Wie könnten die Substanzen in den Exkrementen der Heerwurmraupen die Abwehrreaktion der Maispflanzen bewirken?

    Lösung

    a. Dies stellt eine induzierte Abwehr da, weil die Exkremente einen Elicitor enthalten.
    b. Chemische Verbindungen in den Exkrementen fungieren als Elicitoren und lösen Signaltransduktionswege aus. Bei einem der Signalwege kommt es zu Veränderungen des elektrischen Potenzials der Plasmamembran, die über den Symplasten auf die gesamte Pflanze übertragen werden. Bei einem weiteren Signalweg wird die Produktion reaktiver Sauerstoffspezies induziert; diese wirken als Signalmoleküle in Wegen, die zu Veränderungen der Genexpression führen. Ein anderer Signalweg führt zur Produktion von Jasmonat und anderen Phytohormonen, die systemische Abwehrmechanismen auslösen und sogar auf benachbarte Pflanzen übergehen und bei diesen Abwehrreaktionen in Gang setzen können.
  • Erklären Sie, wie Pflanzen nach einem Herbivorenangriff Jasmonat als „Hilferuf" nutzen können.

    Lösung

    Jasmonate werden als Reaktion auf einen Elicitor gebildet, der von Herbivoren stammt. Sie können die Synthese flüchtiger Substanzen induzieren, die durch die Luft als „Hilferuf" zu anderen Pflanzen oder anderen Organen derselben Pflanze gelangen können.
  • Der Klimawandel könnte in den kommenden Jahrzehnten erheblicheAuswirkungen auf das Wachstum und die Produktivität von Pflanzen haben, insbesondere auf Kulturpflanzen, die unabdingbar für die menschliche Ernährung sind. Welche physiologischen Auswirkungen und möglichen genetischen Reaktionen könnten die folgenden Ereignisse im Hinblick auf die Pflanzenzucht zur Folge haben?
    a. In Pakistan führen geringere Niederschläge zu Ernteeinbußen im Weizenanbau.
    b. Im Mekongdelta in Vietnam werden durch den Anstieg des Meeresspiegels Reisfelder überflutet, was einen drastischen Rückgang der Ernte nach sich zieht.

    Lösung

    a. Die verringerten Regenfälle könnten unter anderem eine Dehydrierung und osmotischen Stress zur Folge haben. Als genetische Reaktionen wären denkbar: Änderungen der Blattanatomie, mit einer dickeren Cuticula zur Verringerung der Verdunstung; ein stärker ausgeprägtes Wurzelsystem zur Wasseraufnahme; Anreicherung von gelösten Stoffen in den Wurzeln – dadurch würde sich das Wasserpotenzial der Wurzeln verringern, und die Wurzeln könnten mehr Wasser aus den ausgetrockneten Böden aufnehmen.
    b. Durch die Überflutung reduziert sich die Menge an Sauerstoff, die den Pflanzen zur Verfügung steht, und damit die Zellatmung. Mögliche genetische Reaktionen könnte eine verstärkte Bildung von Atemwurzeln oder Aerenchymen sein, um die untergetauchten Pflanzengewebe mit Luft zu versorgen.
  • Bewässerungsmaßnahmen führen dazu, dass sich im Boden zunehmend Salz anreichert. Eine Agrarwissenschaftlerin möchte Getreidesorten entwickeln, die resistent gegen höhere Salzkonzentrationen sind. Welche Art von Genen könnte sie dazu in das Genom der Getreidepflanzen einschleusen? Und wie würden diese Gene eine bessere Resistenz der Pflanzen gegenüber Salz bewirken?

    Lösung

    Sie könnte Gene für Proteine einschleusen, die zur Bildung von Salzdrüsen führen, oder Gene für Membranproteine, durch die überschüssiges Salz in der Zentralvakuole gespeichert werden kann. Wenn das Salz in der Vakuole von der übrigen Zelle separiert wird, kann es dort nicht andere Verbindungen und Reaktionen beeinträchtigen
  • Die Beseitigung von toxischen Schadstoffen an einem Standort durch Phytosanierung (Phytoremediation) hat einen Nachteil: Manche der dazu eingesetzten Hyperakkumulatoren wachsen nur sehr langsam und produzieren wenig Biomasse.
    a. Warum ist dies ein Nachteil?
    b. Schlagen Sie Möglichkeiten vor, wie dieser Nachteil vielleicht umgangen wird.

    Lösung

    a. Durch die fehlende Pflanzendecke können sich toxische Ionen im Boden anreichern.
    b. Die beteiligten Gene könnten Proteine codieren, die toxische Ionen von den Pflanzenzellen bzw. dem Cytoplasma der Zellen fernhalten (indem die Ionen z.B. in Drüsen oder in der Zentralvakuole gespeichert werden).
  • Wodurch wird die Größe einer einzelnen Zellebeschränkt?

    Lösung

    Zellen sind in ihrer Größe beschränkt, weil ihre Oberfläche ausreichen muss, um ihre metabolischen Bedürfnisse per Diffusion und Transport von Nährstoffen sowie Abfallprodukten durch die Plasmamembran sicherzustellen.
  • Welche Vorteile hat ein vielzelliger Organismus gegenüber einem Einzeller?

    Lösung

    Der Hauptvorteil der Vielzelligkeit besteht darin, dass nicht jede Zelle für all ihre metabolischen Bedürfnisse sorgen muss. Unterschiedliche Zellen können sich auf bestimmte Funktionen spezialisieren, die zum Überleben und zur biologischen Fitness des gesamten Organismus beitragen. Diese Spezialisierung bringt eine höhere Effizienz mit sich. Zudem umgeht Vielzelligkeit das Problem des sinkenden Oberflächen/Volumen-Verhältnisses, das mit einer Größenzunahme von Organismen einhergeht. Ein dritter Vorteil ist, dass größere Organismen weniger leicht Jägern zum Opfer fallen und selbst leichter Beute machen können.
  • Erklären Sie anhand eines Beispiels, in welcher Weise verschiedene Gewebetypen am Aufbau eines Organs beteiligt sind. Was trägt jeder Gewebetyp zur Funktion dieses Organs bei?

    Lösung

    Der Verdauungstrakt ist ein gutes Beispiel dafür, wie mehrere Gewebe zur Struktur und Funktion eines Organs beitragen können. Epithelgewebe sorgen für die Abgrenzung zwischen dem Darmtrakt und seinem Lumen, wo die Nahrung verdaut wird, und liefern zudem Verdauungsenzyme sowie Transportmechanismen für die Resorption von Nährstoffbausteinen. Muskelgewebe liefert die nötige Peristaltik, um den Darminhalt vom Mund zum Anus zu transportieren. Nervengewebe kontrolliert die Darmperistaltik und liefert zudem sensorische Informationen, die zur Kontrolle der Darmfunktionen dienen. Bindegewebe verleihen dem Darm strukturelle Integrität, und ein flüssiges Bindegewebe – Blut – transportiert Nährstoffbausteine aus dem Darm zu allen anderen Zellen im Körper.
  • Warum ist der Erhalt des inneren Milieus ein zentrales Thema der Tierphysiologie?

    Lösung

    Der Erhalt des inneren Milieus steht im Mittelpunkt der Tierphysiologie, weil das innere Milieu für die Deckung sämtlicher Bedürfnisse der Zellen im Körper sorgt. Die Zelltypen eines Tieres sind darauf spezialisiert, etwas zum Erhalt des inneren Milieus beizutragen, aber keine Tierzelle kann alle ihre eigenen Bedürfnisse erfüllen und kann daher auch nicht allein existieren.
  • Erklären Sie den Unterschied zwischen negativem Feedback, positivem Feedback und Feedforward-Kontrollmechanismen.

    Lösung

    Negatives Feedback liefert Information über die geregelte Variable, die mit einem Sollwert verglichen werden kann, um ein Fehlersignal zu generieren. Das Fehlersignal wird an Effektororgane übermittelt, um die geregelte Variable zurück auf den Sollwert zu bringen. Positives Feedback liefert Information über die geregelte Variable, die in Kommandosignale umgewandelt werden kann, welche die geregelte Variable weiter von ihrem Sollwert wegschieben. Feedforward-Information verändert den Sollwert in Erwartung eines Ungleichgewichts, sodass die geregelte Variable stabil bleiben kann, wenn sich die Bedingungen ändern.
  • Schätzen Sie anhand Ihrer Körpermasse, wie viel Wasser Ihr Körper enthält. Wie groß sind Ihr intrazelluläres und Ihr extrazelluläres Flüssigkeitsvolumen wie auch Ihr Blutplasmavolumen?

    Lösung

    Bei 60 kg Körpergewicht enthalten Sie ca. 36 l Wasser. Davon sind 2/3 intrazellulär (24 l) und 1/3 extrazellulär (12 l). Davon wiederum sind 80 % interstitielle Flüssigkeit (9,6 l) und 20 % Blutplasma (2,4 l).
  • Evans Blue ist ein Azofarbstoff, der im Blut an das Serumprotein Albumin bindet und deshalb die Blutbahn nicht verlassen kann. Mannitol (auch Mannit) ist ein Zuckeralkohol, der in der Computertomographie als Kontrastmittel verwendet wird und aus der Blutbahn leicht in die interstitielle Flüssigkeit übertritt. Wie könnten Sie mithilfe dieser beiden Stoffe das Volumen der interstitiellen Flüssigkeit eines Probanden bestimmen?

    Lösung

    Sie injizieren ein bekanntes Volumen (V1) von Mannitol und Evans Blue in bekannter Konzentration (C1) in die Blutbahn eines Probanden. Nachdem genügend Zeit vergangen ist, in der sich die injizierte Lösung im ganzen Körper verteilt hat, nehmen Sie eine Blutprobe und messen die Konzentration von Evans Blue oder Mannitol im Blutplasma (C2). Aus dem Verdünnungsfaktor von Mannitol können Sie auf das Volumen der extrazellulären Flüssigkeit schließen und aus dem Verdünnungsfaktor von Evans Blue auf das Blutvolumen. Die Differenz ergibt das Volumen der interstitiellen Flüssigkeit.
  • Erklären Sie, wie Fluktuationen der Körpertemperatur komplexe physiologische Prozesse stören können.

    Lösung

    Schwankungen der Körpertemperatur können komplexe physiologische Prozesse stören, weil unterschiedliche Stufen oder Komponenten dieser Prozesse wahrscheinlich leicht unterschiedliche Q10-Werte haben. Daher kann eine Temperaturveränderung die Zusammenarbeit dieser Schritte oder Komponenten negativ beeinflussen.
  • Zeichnen Sie eine Kurve für einen physiologischen Prozess, der einen Q10 von 2,5 hat.

    Lösung

  • Welches Merkmal von Isoenzymen könnte ihre Rolle bei der saisonalen metabolischen Temperaturakklimatisierung erklären?

    Lösung

    Isoenzyme können unterschiedliche Temperaturoptima haben; daher kann die Expression unterschiedlicher Isoenzyme mit Temperaturoptima, die an die jahreszeitlichen Veränderungen angepasst sind, zu einer saisonalen Akklimatisierung führen.
  • Warum ist die Körpertemperatur eines Ektothermen, der umweltbedingten Temperaturschwankungen ausgesetzt ist, in der Natur konstanter als im Labor?

    Lösung

    In freier Natur kann ein Ektothermer Verhaltensanpassungen nutzen, wie ein Bad in der Sonne oder das Aufsuchen von Schatten, um signifikante Veränderungen seiner Körpertemperatur zu vermeiden. Im Labor hat ein Tier nicht die Möglichkeit, sich auf diese Weise anzupassen.
  • Wenn Sie sich die vier Wege des Wärmeaustauschs anschauen – was entscheidet darüber, ob Wärme aufgenommen oder abgegeben wird?

    Lösung

    Das Tier nimmt Wärme durch Radiation, Konduktion oder Konvektion auf, wenn die Strahlung bzw. der Gegenstand bzw. die Wind- oder Wasserströmung wärmer ist als seine Oberflächentemperatur, und das Tier verliert Wärme durch alle drei Prozesse, wenn das Temperaturgefälle umgekehrt ist. Die Evaporation kann nur zu einem Wärmeverlust des Tieres führen, und das Ausmaß dieses Wärmeverlusts hängt von der Wassermenge ab, die auf einer wärmeaustauschenden Oberfläche wie Haut oder Atemwege verdunstet.
  • Erklären Sie die Anpassungen im Kreislaufsystem, die es den „warmen“ Fischen im Gegensatz zu anderen, „kalten“ Fischen ermöglichen, die Temperatur in ihrer Schwimmmuskulatur zu erhöhen.

    Lösung

    Bei Fischen strömt das Blut aus dem Herz in die Kiemen, wo es zu einem Temperaturausgleich mit dem umgebenen Wasser kommt. Bei den meisten Fischen fließt dieses Blut dann im Zentrum des Fisches durch ein großes Gefäß, das sich in zahlreiche kleinere Gefäße aufteilt, die die Gewebe des Fisches perfundieren und sie dadurch kühlen. Bei „warmen“ Fischen strömt der größte Teil des Blutes von den Kiemen durch periphere Gefäße, aus denen kleinere segmentale Gefäße entspringen, die ins Muskelgewebe ziehen. Diese Gefäße transportieren Blut nach innen (Arterien) und verlaufen parallel und eng neben den Gefäßen, die Blut nach außen transportieren (Venen). Die Venen führen Wärme mit sich, die in der Muskulatur erzeugt wurde, doch durch diesen Gegenstromblutfluss in den Arterien und Venen erwärmt das venöse Blut das arterielle Blut, das in den Muskel strömt, und senkt damit den Wärmeverlust aus dem Muskelgewebe. Ein Gegenstromwärmeaustausch bei „warmen“ Fischen sorgt dafür, dass die Wärme, die von den mächtigen Schwimmmuskeln erzeugt wird, im Muskelgewebe bleibt.
  • Was bestimmt die Ober- und die Untergrenze der Thermoneutralzone?

    Lösung

    In der Thermoneutralzone kann der Metabolismus auf Grundniveau bleiben, denn die Regulation der Körpertemperatur lässt sich durch passive Maßnahmen wie eine veränderte Hautdurchblutung oder eine veränderte Körperhaltung erreichen. Wenn die Umgebungstemperatur jedoch sinkt, ist irgendwann ein Punkt erreicht, wo eine aktive Thermoregulation erforderlich wird, die zu einer Zunahme der Stoffwechselaktivität führt. Dieser Punkt ist die untere kritische Temperatur. Umgekehrt wird, wenn die Umgebungstemperatur steigt, ein Punkt erreicht, an dem eine verstärkte Hautdurchblutung und eine veränderte Körperhaltung einen Anstieg der Kerntemperatur nicht mehr verhindern können und aktive Mechanismen wie Schwitzen oder Hecheln erforderlichsind, was zu einem Anstieg der Stoffwechselrate führt. Dieser Punkt ist die obere kritische Temperatur.
  • Erklären Sie, warum arktische Säugerarten in der Regel größer und stämmiger sind als eng verwandte Arten, die in wärmeren Gefilden leben.

    Lösung

    Wärme geht über die Körperoberfläche verloren, daher hat ein größeres, massigeres Tier ein niedrigeres Oberflächen/Volumen-Verhältnis als ein kleineres, schlankeres Tier. Deshalb hat die natürliche Selektion bei eng verwandten Arten in kälteren Regionen die größeren, kompakter gebauten Arten bevorzugt.
  • Welche Rolle spielt Feedforward-Information für das thermoregulatorische System von Säugern?

    Lösung

    Feedforward-Information dient dazu, Sollwerte in Erwartung eines zukünftigen Stressors zu verstellen. So kann eine Kälteexposition beispielsweise den Sollwert für die metabolische Wärmeproduktion erhöhen, sodass der erhöhte Wärmeverlust des Körpers an die kalte Umgebung ausgeglichen wird, ohne dass die Kerntemperatur fallen müsste, um die Reaktion auszulösen.
  • Erklären Sie, warum das thermoregulatorische System von Säugern als proportionaler Thermostat mit einem einstellbarenSollwert beschrieben worden ist.

    Lösung

    Der Thermostat von Säugern wird als proportionaler Thermostat mit einstellbarem Sollwert beschrieben, denn die Intensität, mit der er die Effektororgane antreibt, ist zur Differenz zwischen hypothalamischer Temperatur und einer hypothalamischen Schwellentemperatur für die Aktivierung dieser Reaktion proportional. Der Begriff „einstellbarer Sollwert“ bezieht sich auf die Rolle der Feedforward-Information bei der Veränderung der hypothalamischen Temperaturschwellen für unterschiedliche thermoregulatorische Reaktionen.
  • Warum wirkt Adrenalin schneller als Östrogen?

    Lösung

    Adrenalin ist ein Aminosäurederivat, das gelöst im Blut transportiert wird und an Rezeptoren auf der Zelloberfläche bindet, um so eine intrazelluläre Signalkaskade auszulösen, die zu einer sofortigen Antwort führt. Östrogen ist ein Steroidhormon, das zusammen mit einem Proteincarrier im Blut transportiert wird. Da es lipidlöslich ist, diffundiert es in die Zielzellen hinein und bindet an einen intrazellulären Rezeptor, der dann in den Zellkern verlagert wird und die Genexpression verändert. Die Reaktionen auf das Hormon werden anschließend durch die Produkte dieser Genexpression vermittelt – und all das benötigt mehr Zeit als die Adrenalinwirkung.
  • Warum ist die Präsenz eines bestimmten Hormons bei zwei Arten kein Hinweis auf eine enge phylogenetische Verwandtschaft?

    Lösung

    Die Präsenz desselben Hormons bei zwei Arten ist kein Indikator für eine enge phylogenetische Verwandtschaft, weil die Struktur von Hormonen hoch konserviert ist, selbst wenn sich ihre Funktion ändert. Daher können entfernt verwandte Arten dieselben Hormone besitzen.
  • Wie kann ein und dasselbe Hormon bei derselben Art zwei verschiedene Wirkungenhaben?

    Lösung

    Ein und dasselbe Hormon kann bei derselben Art je nach Typ der Zellen, die die entsprechenden Rezeptoren exprimieren, und auch je nach Typ der Rezeptoren selbst, die unterschiedliche Signaltransduktionswege aktivieren können, unterschiedliche Effekte auslösen.
  • Liefern Sie eine entwicklungsphysiologische Erklärung für die Tatsache, dass Neurohypophysenhormone aus Neuronen freigesetzt werden, Adenohypophysenhormonehingegen aus Epithelzellen.

    Lösung

    Während der Embryonalentwicklung entsteht die Neurohypophyse (Hypophysenhinterlappen) aus einer Ausstülpung am Boden des sich entwickelnden Gehirns, die Adenohypophyse (Hypophysenvorderlappen) hingegen aus einer Ausstülpung des embryonalen Munddachs. Daher besteht die Neurohypophyse aus Nervengewebe, und es sind Nervenzellen, die die Neurohypophysenhormone produzieren und freisetzen. Die Adenohypophyse entsteht hingegen aus Darmepithelgewebe, und die sekretorischen Zellen entwickeln sich aus Darmepithelzellen.
  • Wie kontrollieren Hypothalamusneuronen die Freisetzung von Hormonen aus der Adenohypophyse?

    Lösung

    Hypothalamische Neuronen setzen geringe Mengen von Releasing- oder Release-Inhibiting-Hormonen frei, die in das zwischen dem Hypothalamus und der Adenohypophyse gelegene Pfortadersystem diffundieren. Diese hypothalamischen Hormone treten in der Adenohypophyse aus den Pfortaderkapillaren aus und diffundieren zu adenohypophysären Zellen, die geeignete Rezeptoren für diese speziellen Releasing- oder Release-Inhibiting-Hormone aufweisen. Diese Zellen in der Adenohypophyse reagieren, in dem sie die Freisetzung ihrer Hormone verändern, zu denen vier glandotrope Hormone (thyroideastimulierendes Hormon, adrenocorticotropes Hormon sowie die Gonadotropine luteinisierendes Hormon und follikelstimulierendes Hormon) und Somatotropin (Wachstumshormon) gehören.
  • Erklären Sie, was mit negativer Rückkopplung bei der hypothalamischen Kontrolle der endokrinen Funktion gemeint ist.

    Lösung

    Für die negative Rückkopplung der hypothalamischen Kontrolle der endokrinen Funktion spielt die hemmende Wirkung des Endhormons auf die Produktion des Releasing-Hormons (oder Release-Inhibiting-Hormons) im Hypothalamus eine entscheidende Rolle. Das Endhormon kontrolliert also die adenohypophysären Zellen, welche die glandotropen Hormone produzieren, die ihrerseits die Zellen oder die Drüse kontrollieren, welche das Endhormon produzieren und freisetzen.
  • Warum verhinderte das Dekapitieren von Rhodnius die Häutung, wenn es eine Stunde nach der Blutmahlzeit geschah, aber nicht, wenn der Eingriff eine Woche nach der Blutmahlzeit vorgenommen wurde?

    Lösung

    Die Dekapitierung von Rhodnius verhindert die Häutung des Tieres, wenn sie eine Stunde nach der letzten Blutmahlzeit erfolgt, nicht aber, wenn der Eingriff eine Woche später vorgenommen wird. Der Grund dafür ist, dass PTTH eine gewisse Zeit benötigt, um freigesetzt zu werden und in so großen Mengen zur Prothoraxdrüse zu diffundieren, dass es dort die Freisetzung von Ecdyson anregen kann.
  • Wie kann ein Individuum mit einem XY-Genotyp einen weiblichen Phänotyp entwickeln?

    Lösung

    Der äußerlich weibliche Phänotyp ist die „Standardeinstellung“ beim Menschen. Diese wird bei einem normalen XY-Individuum dadurch geändert, dass Gene auf dem Y-Chromosom aktiv werden, die die Entwicklung von Hoden statt von Eierstöcken anregen. Die Hoden produzieren das männliche Sexualhormon Testosteron, das die Entwicklung des äußerlich männlichen Phänotyps fördert. Wenn einem Individuum jedoch die Rezeptoren für das männliche Sexualhormon fehlen, kann Testosteron nicht wirken, und es entwickelt sich der weibliche Phänotyp.
  • Welche Rolle spielt die negative Rückkopplung beim Einsetzen der Pubertät?

    Lösung

    Bei präpubertären Individuen werden Sexualhormone in geringer Menge produziert; diese Mengen reichen aus, um den Hypothalamus über eine negative Rückkopplungsschleife an der Produktion von GnRH zu hindern. Infolgedessen wird kaum LH und FSH aus der Adenohypophyse ausgeschüttet. Mit Einsetzen der Pubertät verringert sich jedoch die Empfindlichkeit des Hypothalamus für die zirkulierenden Geschlechtshormone, sodass die negative Feedback-Kontrolle gelockert wird. Daher steigen Produktion und Sekretion von GnRH sowie von LH und FSH an und lösen die mit der Pubertät einhergehenden Veränderungen aus.
  • Beschreiben Sie, warum sowohl eine Schilddrüsenüberfunktion als auch eine -unterfunktion zur Kropfbildung führen kann.

    Lösung

    Eine Hauptursache für eine Schilddrüsenunterfunktion (Hypothyreose) ist Jodmangel. Ohne adäquate Jodzufuhr kann die Schilddrüse kein aktives T3 und T4 sezernieren. Infolgedessen gibt es kein negatives Feedback für die Produktion des Thyreotropin-Releasing-Hormons (TRH) und des thyroideastimulierenden Hormons (TSH). Der erhöhte TSH-Spiegel führt zu einer gesteigerten Thyreoglobulinproduktion und so zu einem Wachstum der Schilddrüse. Ein Hauptgrund für eine Schilddrüsenüberfunktion ist die Produktion eines Antikörpers gegen den TSH-Rezeptor, der an den Rezeptor bindet und ihn aktiviert hält. Daraus resultiert eine ständig erhöhte Thyreoglobulinsynthese. Obgleich die Betroffenen aktives T3 und T4 produzieren, gibt es keine negative Rückkopplung, die auf das System Hypothalamus-Hypophyse-Schilddrüse einwirken könnte.
  • Wie trägt Vitamin D zur Erhöhung des Calciumspiegels im Blut bei, und warum ist es kein echtes Vitamin?

    Lösung

    Die Aufnahme von Vitaminen mit der Nahrung ist nötig, weil der Körper diese Verbindungen nicht selbst synthetisieren kann. Vitamin D wird im Körper durch das Einwirken von UV-Strahlung auf Vorläufermoleküle in der Haut produziert, das inCalciferole umgewandelt wird; daher handelt es sich nicht um ein Vitamin. Die Calciferolewerden von Enzymen in Leber und Nieren in die aktive Form Calcitriol umgewandelt. Calcitriol (Vitamin D) fördert die Aufnahme von Calciumionen aus Darm und Nieren und erhöht dadurch den Calciumspiegel im Blut.
  • Wie kontrolliert Insulin die Rate der Glucoseaufnahme durch die Zellen?

    Lösung

    Insulin kontrolliert die Rate der Glucoseaufnahme in Zellen, indem es die Zellen veranlasst, Glucosetransporter (passive Transporter) in die Plasmamembran einzufügen, die aus einem Pool solcher Rezeptoren im Cytoplasma stammen. Die Glucosetransporter in der Plasmamembran erhöhen die Permeabilität der Zelle für Glucose, die dann in die Zelle diffundieren kann, solange ihre Konzentration in der extrazellulären Flüssigkeit hoch genug ist.
  • Erklären Sie, wie chronischer Stress zu stressbedingten Erkrankungen führen kann.

    Lösung

    Stress fördert die Freisetzung von Cortisol aus der Nebennierenrinde. Cortisol hilft dem Körper beim Umgang mit kurzfristigem Stress, indem es die zelluläre Aufnahme von Glucose reduziert, den Blutdruck erhöht und die Aktivität von Verdauungstrakt, Fortpflanzungssystem sowie Immunsystem verringert. Kurzfristig steht damit mehr Energie zur Verfügung, um mit dem unmittelbaren Stressor fertig zu werden. Negatives Feedback von Cortisol, das über den Hypothalamus und die Hypophyse wirkt, stellt die Cortisolreaktion auf kurzzeitigen Stress normalerweise wieder ab. Wenn der Stress jedoch chronisch wird, wie in einer schwierigen Lebenssituation, bleibt der Cortisolspiegel hoch und der daraus resultierende erhöhte Blutdruck kann zu Herz-Kreislauf-Erkrankungen führen, die Beeinträchtigung des Immunsystems zu Infektionen und Krankheiten, die Störung Verdauungsfunktion zu Magen-Darm-Geschwüren und der beeinträchtigte Glucosestoffwechsel zu Diabetes.
  • Beschreiben Sie drei Merkmale der angeborenen und der adaptiven Immunabwehr, die beide Systeme voneinander unterscheiden.

    Lösung

    Die angeborene Immunabwehr ist wenig spezifisch,setzt schnell ein und erkennt ein breites Spektrum unterschiedlicher Klassen von Organismen oder Molekülen. Die adaptive Immunabwehr ist hochspezifisch und entwickelt sich langsamer, ist aber langlebiger.
  • Bei einigen Menschen läuft aufgrund einer seltenen Erbkrankheit die TLR-Signalkaskade fehlerhaft ab. Wie könnte sich das auf den Phänotyp der Betroffenen auswirken?

    Lösung

    Die TLR-Signalkaskade spielt bei der angeborenen Immunität gegenüber bakteriellen Infektionen eine Rolle. Bakterien besitzen Moleküle, die als pathogenassoziierte molekulare Muster (PAMPs) fungieren. Diese Moleküle aktivieren dieTLR-Signalkaskade. Das hat zur Folge, dass Leukozyten Cytokine und andere Abwehrproteine bilden. Wenn dies nicht geschieht, sind die Betroffenen sehr anfällig für bakterielle Infektionen.
  • Nehmen Sie an, Sie verglichen die Genome eines Insekts und eines Menschen in Hinblick auf die Anwesenheit von Genen, die bei der Immunabwehr eine Rolle spielen. Was würden Sie herausfinden?

    Lösung

    Sowohl im Genom des Insekts wie auch in dem des Menschen sind Gene für eine angeborene Immunabwehr wie für Barrieren und die TLR-Signalkaskade vorhanden. Der Mensch besitzt jedoch zusätzlich Gene für eine adaptive Immunabwehr: für Antikörper, T-Zell-Rezeptoren und T- und B-Zellen.
  • Ein pathogenes Bakterium landet auf Ihrer Haut. Erläutern Sie die angeborenen Abwehrmechanismen, die nun wirksam werden.

    Lösung

    Die physikalische Barriere der Haut verhindert eine Infektion. Schleim fängt Bakterien ab und entfernt sie, sodass sie nicht infektiös werden können. Lysozyme hydrolysieren die Zellwände von Bakterien. Defensine machen die Plasmamembranen der Bakterien permeabel. Wenn Bakterien durch die Haut eindringen, kommen sie in Kontakt mit Komplementproteinen, die die Phagozytose auslösen. Phagocyten zerstören die Bakterien.
  • Ihr Immunsystem reagiert auf ein Staubkorn auf Ihrer Haut nicht mit einem angeborenen Abwehrmechanismus, aber es reagiert womöglich auf ein Bakterium. Warum?

    Lösung

    Das Bakterium weist spezifische Strukturmotive oder Moleküle auf, die man PAMPs nennt. Diese werden von Rezeptoren auf den Körperzellen des Menschen erkannt und lösen eine Antwort aus. Auf einem Staubkorn sind keine PAMPs vorhanden.
  • Wenn ein Holzsplitter die Haut durchdringt, kommt es zu einer Schwellung. Warum?

    Lösung

    Der Holzsplitter ruft eine Entzündung hervor.
  • Im Zug niest ein Fahrgast neben Ihnen. Das Erkältungsvirus gelangt in Ihre Nase. Wie reagiert ihr Körper? Beachten Sie die Arten und Schritte der adaptiven Immunabwehr.

    Lösung

    humorale Immunantwort: Die freien Viren binden an B-Zellen, die Antikörper gebildet haben, welche mit viralen Antigenen reagieren (Erkennung). Diese B-Zellen teilen sich daraufhin und bilden Klone. Ein Klon produziert noch mehr Antikörper gegen die Viren. Diese Antikörper binden an freie Viren im Blut, und Phagocyten zerstören die Virus-Antikörper-Komplexe.
    zelluläre Immunantwort: Die virusinfizieren Zellen im Atemtrakt. Einige dieser Zellen spalten die viralen Proteine und präsentieren Fragmente auf ihrer Oberfläche (Antigenpräsentation). T-Zellen, deren T-Zell-Rezeptoren an die Virenfragmente binden können, binden an den antigenpräsentierenden Zellen. Diese T-Zellen stimulieren die Bildung von cytotoxischen T-Zellen, die die virusinfizierten Zellen töten können.
  • 2009 verbreitete sich ein H1N1-Stamm des Influenzavirus auf der ganzen Erde. Bei Menschen, die bereits die Grippeepidemie von 1918 erlebt hatten, waren die Infektionsraten gering. Erklären Sie dies imHinblick auf das immunologische Gedächtnis.

    Lösung

    Die älteren Menschen besaßen Gedächtniszellen, die Antikörper gegen den Stamm des Grippevirus von 1918 bilden konnten. Weil dieser Stamm dem Stamm von 2009 ähnlich war, zeigten diese Menschen eine starke Immunantwort.
  • Wie machen sich Impfstoffe das immunologische Gedächtnis zunutze?

    Lösung

    Impfstoffe sind inaktive Antigene, die dennoch in der Lage sind, eine Immunantwort hervorzurufen. Die Impfung fördert die Bildungvon Klonen, die Antikörper (B-Zellen) oder T-Zell-Rezeptoren (T-Zellen) bilden, welchean das injizierte, virale Antigen binden. Einige Gedächtniszellen überdauern.Sie können eine starke Immunantwort auslösen, wenn zu einem späteren Zeitpunktein Virus (mit dem Antigen)infektiös wird.
  • Beschreiben Sie den Teil eines Antikörpermoleküls, der mit einem Antigen interagiert. Inwiefern ähnelt er dem aktiven Zentrum eines Enzyms? Was sind die Unterschiede?

    Lösung

    Die Antigenbindungsstelle eines Antikörpers wird von der variablen Region einer schweren und einer leichtenKette gebildet und weist eine einzigartige dreidimensionale Struktur auf, die an eine bestimmte Antigendeterminante bindet. Ähnlich bindet das aktive Zentrum eines Enzyms an einSubstrat. In beiden Fällen handelt es sich um nichtkovalente Wechselwirkungen. Ein Unterschied könntedarin bestehen, dass bei einem Enzym-Substrat-Komplex induced-fit (induzierte Passform) sehr oft eine entscheidende Rolle spielt, während das bei einem Antigen-Antikörper-Komplex nicht unbedingt der Fall sein muss (aber oft ist). Ein Hauptunterschied ist, dass Enzyme ihr Substrat chemischverändern, Antikörper ihr Antigen jedoch nicht.
  • Vergleichen Sie Immunglobuline und T-Zell-Rezeptoren imHinblick auf ihre Struktur und Funktion.

    Lösung

    Sowohl Immunglobuline wie auch T-Zell-Rezeptoren besitzen konstante und variable Proteinregionen, binden Antigene und weisen eine große Variabilität der Primärstruktur auf. T-Zell-Rezeptoren sind Membranproteine von T-Zellen. Immunglobuline können entweder Membranproteine von B-Zellen oder in das Blut sezernierte, lösliche Proteine sein.
  • Erläutern Sie die Vielfalt spezifischer Antikörper eines Individuums im Vergleich mit der Vielfalt seiner Enzyme. Enthält jede Zelle eines Tieres genetische Informationen für alle Enzyme des Organismus? Für alle Immunglobuline? Begründen Sie Ihre Antwort.

    Lösung

    In einem Individuum gibt es Tausende unterschiedliche Enzyme, aber es können mehrere Millionen unterschiedliche spezifische Antikörper gebildet werden. Jede Zelle eines Tieres besitzt die genetische Information für alle seine Enzyme. Jedes Immunglobulin dagegen leitet sich von einem einzigartigen Gen einer B-Zelle oder eines Klons ab, das durch DNA-Umstrukturierungen gebildet wurde.
  • Bei nicht miteinander verwandten Menschen unterscheiden sich die MHC-Proteine fast immer. Organtransplantationen lösen deshalb meist eine zelluläre Immunantwort beim Empfänger aus, die zu einer Abstoßungsreaktion führt. Menschen, denen Organe transplantiert werden, verabreicht man den Wirkstoff Ciclosporin (Cyclosporin A), das die Entwicklung der T-Zellen hemmt. Wie könnte Ciclosporin wirken?

    Lösung

    Indem Ciclosporin die T-Zell-Entwicklung unterbindet, verhindert es, dass TH-Zellen an transplantierte Zellen binden. Deshalb bleibt eine zelluläre Immunabwehr aus. Würde die TH-Zelle binden, dann würden Cytokine freigesetzt, die TC-Zellen anlocken. Diese würden die transplantierten Zellen töten.
  • Wenn ein Virus eine Zelle infiziert, zeigt das Immunsystem eine adaptive Antwort auf die Infektion. Welche Rolle spielen die T-Zell-Rezeptoren und MHC-Proteine bei der Antwort?

    Lösung

    In der infizierten Zelle werden die Makromoleküle des Virus in Fragmente zerlegt. Einige Fragmente werden gemeinsam mit einem MHC-Klasse-I-Proteinauf der Zelloberfläche präsentiert. Eine cytotoxische T-Zelle, die einen für das Peptid der Zielzelle spezifischen T-Zell-Rezeptor trägt, bindet an die Zielzelle und löst die zelluläre Immunantwort aus.
  • Tumorzellen exprimieren oft Proteine, die der Körper noch nicht kennt. Deshalb werden sie vom zellulären adaptiven Immunsystem angegriffen. Bei einigen Krebsarten sind jedoch die Treg-Zellenin größerer Zahl vorhanden und aktiver. Weshalb führt dies zu einer schlechten Prognose?

    Lösung

    Die vermehrte Aktivität der Treg-Zellenverhindert die zelluläre Immunantwort, sodass der Tumor vom adaptiven Immunsystem nicht angegriffen wird.
  • Einige Menschen reagieren allergisch auf Erdnüsse. Beschreiben Sie die Prozesse, die für die beteiligte Immunreaktion typisch sind.

    Lösung

    Ein in Erdnüssen enthaltenes Antigen bindet an einer B-Zelle, die einen Antikörper gegen das Erdnussprotein präsentiert. Dies löst die Bildung eines Klons von Plasmazellen aus, die anfangs IgG bilden und dann auf IgE umstellen. IgE bindet an Mastzellen, die Histamin freisetzen, was die Symptome der Allergie auslöst.
  • Es gibt Fortschritte hinsichtlich einer Desensibilisierung bei einer Erdnussallergie. Wie funktioniert eine solche Desensibilisierung?

    Lösung

    Bei der Desensibilisierung wird der betroffenen Person eine geringe Menge Erdnussprotein verabreicht, sodass die IgG-Synthese angeregt wird, jedoch nicht die Synthese von IgE. Deshalb werden keine Mastzellen stimuliert.
  • Eine neue Krebstherapie umfasst die Stimulation der Autoimmunität durch einen Wirkstoff, der CTLA4 inhibiert, ein Protein auf T-Zellen, das die T-Zellen normalerweise daran hindert, eine Autoimmunreaktion auszulösen. Wie wirkt diese Therapie, und welche unerwünschten Wirkungen könnte sie haben?

    Lösung

    Die Anti-CTLA4-Behandlung bei Krebs macht die Blockade der cytotoxischen Antwort der T-Zellen auf Autoantigene rückgängig. Dies hat zur Folge, dass T-Zellen an Tumorzellen binden und sie töten. Eine Nebenwirkung könnte generalisierte Autoimmunität sein.
  • EinImpfstoff gegen HIV muss bei der geimpften Person sowohl die zelluläre als auch die humorale Immunantwort gegen HIV aktivieren. Welche Experimente würden Sie durchführen, um zu überprüfen, ob dieser hypothetische Impfstoff bei der Person tatsächlich beide Formen der Immunantwort aktiviert?

    Lösung

    Bei den Experimenten müsste getestet werden, ob die geimpften Menschen Antikörper gegen HIVaufweisen (humorale Immunität) und ob die T-Zellen gegen HIV-infizierte Zellen aktiv werden (zelluläre Immunität).
  • Was ist bei Knospung und Regeneration gleich, aber anders bei der Parthenogenese?

    Lösung

    Knospung und Regeneration gehen von somatischen Zellen (Körperzellen) des Elterntiers aus, Parthenogenese hingegen startet von einer Keimbahnzelle, einem unbefruchteten Ei.
  • Wird sich die globale Klimaerwärmung wahrscheinlich negativer auf Arten auswirken, die sich asexuell fortpflanzen, oder auf solche, die sich bisexuell fortpflanzen?

    Lösung

    Der globale Klimawandel wird eher einen negativen Einfluss auf Arten mit asexueller Fortpflanzung haben, weil sie eine geringere genetische Vielfalt aufweisen. Das erschwert ihnen die Evolution von adaptiven Veränderungen, um auf die durch den Klimawandel bedingten neuen Herausforderungen zu reagieren.
  • Der Komodowaran ist eine sehr große, sich bisexuell fortpflanzendeEchsenart, die auf der indonesischen Insel Komodo lebt. Ein junger weiblicher Komodowaran namens Flora wurde viele Jahre lang allein im Londoner Zoo aufgezogen. Ein Jahr nach Erreichen der Geschlechtsreife produziertedas Weibchen ein Gelege, aus dem mehrere männliche Echsen schlüpften. Wie pflanzte sich Flora fort? Welchen Vorteil könnte diese Fähigkeit für eine inselbewohnende Art haben? Warum ist es bedeutsam, dass alle Nachkommen Männchen waren?

    Lösung

    Flora muss sich parthenogenetisch fortgepflanzt haben, eine Fähigkeit, die für eine inselbewohnende Art vorteilhaft ist, wenn ein außergewöhnliches Ereignis alle potenziellen Geschlechtspartner eliminiert oder ein Weibchen auf eine andere Insel ohne potenziellen Geschlechtspartner verschlägt. Wenn die Nachkommen einer parthenogenetischen Fortpflanzung männlich sind, könnten sie sich mit ihrer Mutter paaren, um eine neue Population sich bisexuell reproduzierender Individuen in die Welt zu setzen.
  • Unter Crossing-over versteht man den gegenseitigen Austausch von Abschnitten in homologen Chromatiden. Warum kommt es in menschlichen Oocyten häufiger vor als in menschlichen Spermatocyten?

    Lösung

    Menschliche Oocyten bleiben viel länger in der Prophase der ersten meiotischen Teilung als Spermatocyten; daher ist die Gelegenheit für ein Crossing-over viel größer.
  • Falls eine Mutation in einem Säuger zur Eliminierung der Cytoplasmabrücken zwischen Spermatiden führen würde, würden Sie dann erwarten, dass alle von diesem Säuger gezeugten Nachkommen männlich oder weiblich sind? Erklären Sie Ihre Antwort.

    Lösung

    Ohne Cytoplasmabrücken zwischen den Spermatiden von Säugern würden nicht alle Spermatiden Genprodukte vom X-Chromosom erhalten, die offenbar für das Überleben der Spermien entscheidend sind. Daher würde allen überlebenden Spermien ein Y-Chromosom fehlen, und die Nachkommen dieses Individuums wären alle weiblich.
  • Welcher Mechanismus stellt bei laichenden Tieren sicher, dass eine Eizelle von einem Spermium derselben Art und nur von einem einzigen Spermium besamt wird?

    Lösung

    Das Ei ist von Schutzschichten umgeben, die das Spermium am Kontakt mit der Eizellmembran hindern. Die Eizelle sendet artspezifische chemische Lockstoffe aus, die arteigene Spermien dazu veranlassen, zur Eizelle zu schwimmen. Die Schutzhülle des Eies erzeugt auch artspezifische Signalstoffe, die die Akrosomreaktion des Spermiums stimulieren, sodass es Enzyme freisetzt, die durch Hydrolyse einen Weg durch die Schutzhülle bahnen. Der Spermienkopf trägt zahlreiche Kopien des Proteins Bindin, für das es auf der inneren Schutzschicht (Vitellinhülle) des Eies Rezeptoren gibt. Wenn diese Moleküle an ihren Rezeptor binden, nimmt das Spermium Kontakt mit dem Eizellmembran auf und fusioniert mit ihr. Dieses Ereignis löst den schnellen und den langsamen Block gegen Polyspermie aus, die verhindern, dass zusätzliche Spermien mit der Eizellmembran verschmelzen.
  • In welchen drei Situationen ist Hermaphroditismus vorteilhaft?

    Lösung

    Die Chance, einen Geschlechtspartner zu finden, ist gering.
    Sequenzieller Hermaphroditismus wäre vorteilhaft, um bei einer Art, die zahlreiche Nachkommen produziert, welche in derselben Region bleiben, Inzucht zu vermeiden.
    Sequenzieller Hermaphroditismus wäre auch in einer Population vorteilhaft, in der ein einzelnes dominantes Weibchen wesentliche Ressourcenkontrolliert, zum Beispiel ein Revier. Männliche Nachkommen in dieser Population hätten die Chance zur Reproduktion, aber Weibchen nicht, bis das dominante Weibchen abtritt. Dann könnte sich ein Männchen in ein Weibchen verwandeln und den Platz des einen dominanten Weibchens in der Gruppe übernehmen.
  • Was macht ejakuliertes Spermadick und gelatinös, und wie entkommen die Spermien dem Gel, sodass sie sich den weiblichen Genitaltrakt hinaufbewegen können?

    Lösung

    Samen enthalten Fibrinogen, das von den Samenbläschen sezerniert wird. Die Prostata sezerniert ein Gerinnungsenzym, das dazu führt, dass das Fibrinogen polymerisiert und einen Pfropf bildet. Die Prostata sezerniert auch das Enzym Fibrinolysin, das den Pfropf schließlich aufbricht und die Spermien freisetzt.
  • Welche Rolle spielen die Sertoli-Zellen bei der Spermatogenese?

    Lösung

    Sertoli-Zellen ernähren die Spermien und fördern deren Reifung, beginnend mit dem primären Spermatocytenstadium. Sie liefern ein geeignetes Milieu und essenzielle Nährstoffe. Tight Junctions (Verschlusskontakte) zwischen Sertoli-Zellen schützen das sich entwickelnde Spermium vor wasserlöslichen toxischen Substanzen, die im Blut zirkulieren könnten.
  • cGMP wird von einem Enzym namens Phosphodiesterase abgebaut. Wie lässt sich mit einem Inhibitor dieses Enzyms eine erektile Dysfunktion behandeln?

    Lösung

    Eine sexuelle Stimulation des Mannes veranlassen Nervenendigungen im Penis, einen Neurotransmitter freizusetzen, der Endothelzellen in den Blutgefäßen dazu anregt, NO abzugeben. NO diffundiert in die Muskelzellen, die den Durchmesser der Penisarterien kontrollieren, und bewirkt, dass sie durch eine verstärkte Produktion von cGMP erschlaffen. Die resultierende Zunahme des Blutstroms in diese Arterien drückt die Venen zusammen, die Blut aus dem Penis abführen, und die Schwellkörper des Penis füllen sich mit Blut (Erektion). Eine Phosphodiesterase baut cGMP ab, daher verlängert ein Phosphodiesteraseinhibitor die Effekte der cGMP-Produktion.
  • Was bedeutet die Tatsache, dass die Hoden eines präpubertären Jungen auf FSH und LH reagieren?

    Lösung

    Da präpubertäre Hoden auf LH und FSH reagieren, muss ihre Inaktivität entweder an der geringen Produktion und geringen Freisetzung von LH und FSH durch die hypophysären Gonadotropine oder an einer geringen Produktion von GnRH durch den Hypothalamus liegen.
  • Welche Vorgänge im Ovar sind für die Auslösung der Menstruation verantwortlich, und was verhindert die Menstruation, wenn eine Schwangerschaft vorliegt?

    Lösung

    Die Prozesse im Ovar, die zum Eintritt der Menstruation führen, sind die Degeneration des Gelbkörpers (Corpus luteum) und die darauffolgende abnehmende Produktion von Östrogen und Progesteron. Wenn sich jedoch eine Blastocyste im Uterus einnistet, produziert sie humanes Choriongonadotropin (hCG), das den Gelbkörper erhält, bis die extraembryonalen Membranen die Produktion von Östrogen und Progesteron übernehmen.
  • Welche Rolle spielen die Theka-und die Granulosazellen, und wie begrenzen sie die Zahl der ovulierenden Eizellen?

    Lösung

    Die Granulosazellen ernähren das sich entwickelnde Ei und liefern ihm Nährstoffe, Wachstumsfaktoren und mRNA. Die Granulosazellen produzieren als Reaktion auf FSH auch Östrogen und Progesteron. Östrogen wird von den Granulosazellen aus Testosteron hergestellt, das von der äußeren Zellschicht des Follikels (den Thekazellen) synthetisiert wird. Östrogen regt die Granulosazellen dazu an, FSH-Rezeptoren zu entwickeln, aber gleichzeitig kontrolliert Östrogen durch negative Feedback-Kontrolle die Produktion und Ausschüttung von FSH aus der Adenohypophyse. In jeden Menstruationszyklus beginnen zahlreiche Follikel zu reifen, aber nur der Follikel mit den meisten FSH-Rezeptoren reift voll heran, wenn der Östrogen- und der FSH-Spiegel fallen.
  • Welche Rolle spielt die positive Rückkopplung zwischen hormonellen und mechanischen Prozessen bei der Geburt?

    Lösung

    Vor Beginn der Wehen nimmt die Kontraktilität der Uterusmuskulatur zu, und gleichzeitig dehnt der wachsende Fetus die Uterusmuskulatur immer stärker. Eine Dehnung der Uterusmuskulatur regt Kontraktionen an, die den Kopf des Fetus auf den Cervix (Gebärmutterhals) drücken. Das stimuliert neuronale Signale, die den Hypothalamus dazu veranlassen, die Freisetzung von Oxytocin aus der Neurohypophyse zu bewirken. Oxytoxin verstärkt die Uteruskontraktionen, was wiederum zu mehr Druck auf die Cervix führt, woraufhin noch mehr Oxytocin aus der Neurohypophyse ausgeschüttet wird – eine positive Rückkopplungsschleife.
  • Welche Verhütungsmethode ist die einzige, die auch vor sexuell übertragbaren Krankheiten schützt? Erläutern Sie Ihre Antwort.

    Lösung

    Ein Kondom ist(außer Enthaltsamkeit)das einzige Verhütungsmittel, das vor der Ansteckung mit Geschlechtskrankheiten schützt, denn wenn es richtig angewandt wird, schützt es beide Partner vor einem Kontakt ihrer Körperflüssigkeiten.
  • Sowohl Verhütungspillen (Antibabypillen) als auch Abtreibungspillen wie RU-486 basieren auf Progesteron als Signalstoff. Wie unterscheiden sie sich in ihrer Wirkweise?

    Lösung

    Die Antibabypille liefert eine hohe Dosis Progesteron. Progesteron übt eine negative Feedback-Kontrolle auf die Hypothalamus-Hypophysen-Achse aus und hemmt so Produktion und Freisetzung von LH und FSH, die für Reifung und Freisetzung einer Eizelle aus dem Ovaressenziell sind. RU-486 ist eine Anti-Progesteron-Pille (Abtreibungspille). Während der Lutealphase des Menstruationszyklus erhält ein hoher Progesteronspiegel vom Gelbkörper die Gebärmutterschleimhaut in einem empfängnisbereiten Zustand, um eine Blastocyste aufnehmen zu können. Wird diese Progesteronwirkung blockiert, kann dies die Einnistung der Blastocyste verhindern oder eine Abstoßung der Schleimhaut fördern.
  • Wie kann man IVF benutzen, um eine Weitergabe von Erbkrankheiten zu verhindern?

    Lösung

    IVF kann eingesetzt werden, um die Weitergabe einer Erbkrankheit zu verhindern, denn im frühen Embryonalstadium können dem Embryo Zellen entnommen und in Kultur gezüchtet werden. Dann können diejenigen Embryonen, die das defekte Gen nicht tragen, selektiv in den Uterus der Mutter eingepflanzt werden.
  • Abgesehen von seinem Kern, was ist der wichtigste Beitrag des Spermiums zur nachfolgenden zellulären Signalgebung im Embryo?

    Lösung

    Das Spermium steuert das Centriol zum Embryo bei, und das Centriol ist der Ursprung der Mikrotubuli der primären Cilien, die verschiedene Signalfunktionen haben.
  • Wie wird der graue Halbmond im befruchteten Froschei erzeugt?

    Lösung

    Das unbefruchtete Froschei weist eine animale (obere) und eine vegetative (untere) Hemisphäre auf. Das äußere Cytoplasma der animalen Hemisphäre ist pigmentiert, das Cytoplasma der vegetativen Hemisphäre hingegen nicht. Das Spermium bindet an die animale Hemisphäre und regt die Rotation des äußeren (cortikalen) Cytoplasmas in Richtung der Eintrittsstelle des Spermienkerns an. Diese Rotation erzeugt gegenüber der Eintrittsstelleein Band hellen pigmentierten Cytoplasmas.
  • Wie kommt es, dass sich β-Cateninaufder Dorsalseite eines Amphibienembryos stärker konzentriert als auf der Ventralseite?

    Lösung

    Im unbefruchteten Froschei sind β-Catenin und sein abbauendes Enzym GSK-3 homogen verteilt. Durch das Eindringen des Spermiums und die cortikale Neuanordnung werden Vesikel, die ein GSK-hemmendes Protein enthalten, vom vegetativen Pol in die Region gegenüber der Eintrittsstelle des Spermienkerns verlagert. Dieses Protein verhindert regional die Degradierung von β-Catenin auf der dorsalen Seite der Blastula.
  • Welches Merkmal des Eies verschiedener Arten entscheidet darüber, ob es zurtotalenoderzur partiellen Furchung kommt?

    Lösung

    Eine totale Furchung tritt bei Eiern auf, die wenig Dotter haben. In diesen Eiern können die ersten Furchungsschritte das Ei vollständig teilen. In Eiern mit viel Dotter können die Furchungsschritte das Ei nicht vollständig durchtrennen, und die Blastula bildet sich als Zellscheibe (Keimscheibe), die oben auf der Dottermasse sitzt.
  • Warum können Gene, die während der Furchung exprimiert werden, eine Rolle bei der Entwicklung von Säugern spielen, aber nicht bei Seeigeln oder Fröschen?

    Lösung

    Die Furchung erfolgt bei Säugern sehr langsam, sodass genug Zeit für eine Genexpression bleibt. Beim Seeigel und beim Frosch erfolgt die Furchung sehr rasch, wobei eine Genexpression zwischen den einzelnen Zellteilungen ausbleibt.
  • Warum können sich bei Deuterostomiernaus einer einzigen Eizelle eineiige Zwillinge entwickeln, bei vielen Protostomiern aber nicht?

    Lösung

    Säuger entwickeln sich nach dem Regulationstyp, das heißt, die Blastomeren sind spätdeterminiert. Wenn man die Blastula daher in zwei Hälften teilt, können sich eineiige Zwillinge entwickeln. Da sich die meisten Protostomier nach dem Mosaiktyp entwickeln, fehlen bei einer geteilten Blastula jeder Hälfte gewisse Elemente und sie kann kein vollständiges Tier entwickeln.
  • Warum vergeht bei Keimbahnzellen zwischen Determination und Differenzierung mehr Zeit als bei Hautzellen?

    Lösung

    Keimbahnzellen werden im Embryo während früher Zellteilungen determiniert, die im Lauf der Blastulabildung (Blastulation) stattfinden. Diese präsumptiven Keimzellen differenzieren sich nicht, bis sich die Gonaden entwickeln, in die sie anschließend einwandern. Hautzellen entwickeln sich aus Ektoderm, das in einem späteren Entwicklungsstadium – im Gastrulastadium – determiniert wird; diese ektodermalen Zellen differenzieren sich rasch und bilden die Epidermis des Embryos.
  • Die Seeigelblastula entwickelt sich zu einer radiärsymmetrischen Larve, die Froschblastula hingegen zu einem bilateralsymmetrischen Embryo. Wie ist dieser Unterschied mit Gastrulationsprozessen in diesen beiden Tiergruppen verknüpft?

    Lösung

    Die Gastrulation beim Seeigel und beim Frosch geht mit einer Einrollung (Involution) weiter, durch die sich ein Blastoporus bildet. Beim Seeigel sind die einwandernden Zellen alle gleich determiniert, doch beim Frosch unterscheiden sich die Gewebeinteraktionen entsprechend der Lage rund um den Blastoporus, und die Involutionszellen werden unterschiedlich determiniert.
  • Was heißt es, die Kriterien „Notwendigkeit“ und „Hinlänglichkeit“ zu erfüllen, und wie nutzt das Spemann-Mangold-Experiment diese Kriterien, um die Rolle der dorsalen Urmundlippe als primärer embryonaler Organisator (Spemann-Organisator) zu demonstrieren?

    Lösung

    Das Kriterium der Notwendigkeit bedeutet, dass eine Komponente eines Prozesses präsent sein muss, damit dieser Prozess abläuft. Spemanns Experiment, bei dem er das befruchtete Ei so einschnürte, dass der graue Halbmond entweder nur in einer Tochterzelle oder in beiden Tochterzellen präsent war, zeigte, dass der graue Halbmond für die Embryonalentwicklung notwendig ist. Das Kriterium der Hinlänglichkeit bedeutet, dass eine Komponente des Prozesses allein dafür sorgen kann, dass der Prozess abläuft. In den Spemann-Mangold-Experimenten demonstrierten die Forscher die Hinlänglichkeit, indem sie zeigten, dass die dorsale Urmundlippe eine andere Achse der Entwicklung stimulierte, wenn sie an eine andere Stelle der Blastula transplantiert wurde.
  • Wie induzieren die Zellen des Spemann-Organisators unterschiedliche Strukturen auf der anterior-posterioren Achse, wenn sie von der dorsalen Urmundlippe in die Kopfregion des Embryos wandern?

    Lösung

    Die ersten „einrollenden“ Zellen des Spemann-Organisators exprimieren den Transkriptionsfaktor Goosecoid. Wenn sich diese Zellen nach vorn bewegen, unterdrückt Goosecoid die Expression gewisser Transkriptionsfaktoren in benachbarten Geweben, die supprimiert werden müssen, damit sich für die Kopfregion geeignete Organe entwickeln können. Zellen, die die dorsale Urmundlippe später verlassen, exprimieren andere Transkriptionsfaktoren, die ebenfalls supprimierend auf die Expression noch anderer Transkriptionsfaktoren in benachbarten Geweben wirken und so die Induktionen von Organen ermöglichen, die der Region angemessen sind.
  • Wie unterscheidet sich die Gastrulation von Sauropsidenvon derjenigen von Amphibien?

    Lösung

    Die Gastrulation von Sauropsiden und Amphibien unterscheidet sich, weil die Blastula von Amphibien kugelförmig ist, während das entsprechende Stadium in der Sauropsidenentwicklung eine flache Zelllage ist, die als Keimscheibe oder Blastodiskus bezeichnet wird. Bei Amphibien finden die Zellbewegungen im Rahmen der Gastrulation durch ein Loch in der Blastula (Blastoporus) statt, während sich in der Keimscheibe der Reptilien ein Längsschlitz bildet (Primitivstreifen) und die Zellbewegungen der Gastrulation durch diesen Schlitz hindurch erfolgen. Bei Amphibien führt die Einwanderung von Zellen durch den Blastoporus zur Bildung des Archenterons (Urdarm). Beim Sauropsidenembryo bildet sich kein Archenteron, sondern die entodermalen und mesodermalen Zellen, die durch den Primitivstreifen einwandern, ziehen weiter nach vorn und bilden den Darm und andere Strukturen.
  • Wie reagiert das über der Chorda liegende Ektoderm auf Signale des Chordamesoderms, die es anweisen, ein Neuralrohr wie auch Neuralleistenzellen zu bilden?

    Lösung

    Das Ektoderm über der Chorda dorsalis verdickt sich auf beiden Seiten der Mittellinie und bildet parallel zur Körperlängsachse Wülste. Diese Neuralwülste wachsen aus, bis sie sich an der Mittellinie treffen und das Neuralrohrbilden. Die am weitesten seitlich liegenden Zellen dieser Neuralwülste lösen sich ab und bilden die Neuralleistenzellen, während weiteres laterales Ektoderm zusammenkommt und miteinander verschmilzt, um das Neuralrohr zu bedecken.
  • Welche Konsequenz könnte eine fehlende Somitenbildung im Embryo haben?

    Lösung

    Ein Somit ist ein segmental und bilateral angeordneter Block mesodermaler Zellen, aus dem sich Wirbel, Rippen, Rumpfmuskulatur und Extremitäten entwickeln.
  • Wie generieren Hox-Gene eine Reihe von Signalen, die ausreichen, um die Differenzierung von Geweben und Organen in der anterior-posterioren Achse zu kontrollieren?

    Lösung

    Wirbeltiere verfügen über Gruppen von Hox-Genen, die auf zahlreichen Chromosomen linear angeordnet sind. Diese Gene werden längs der anterior-posterioren Körperachse in derselben Reihenfolge exprimiert, wie sie auf dem Chromosom angeordnet sind. Infolgedessen erhält jede anterior-posteriore Region des Embryos unterschiedliche Kombinationen von Hox-Gen-Produkten in unterschiedlichen Mengen, sodass eine umfangreiche Kombination von Signalmolekülen entsteht.
  • Welche Keimblätter sind an der Bildung von Dottersack, Allantois, Amnion und Chorion beim Huhn beteiligt?

    Lösung

    Dottersack und Allantois wachsen aus dem Hypoblast aus und bestehen aus Entoderm und Mesoderm. Chorion und Amnion entwickeln sich aus Ektoderm und Mesoderm.
  • Woraus entwickelt sich bei Säugern die Placenta?

    Lösung

    Die Blastocyste teilt sich in einen Trophoblastengruppe von Zellen und eine Hypoblastengruppe von Zellen auf. Der Trophoblast interagiert mit der Uterusschleimhaut, um den Embryo in das Endometrium einzubetten, und um Ausläufer auszubilden, die den Kontakt zu den mütterlichen Blutgefäßen herstellen. Zellen des Hypoblasten wachsen aus, um den Dottersack zu bilden, doch hier gibt es keinen Dotter. Diese Hypoblastenzellen und die Trophoblastenzellen bilden zusammen mit mütterlichem Gewebe die Placenta.
  • Warum reagiert ein menschlicher Embryo im ersten Trimester besonders empfindlich auf Umwelteinflüsse?

    Lösung

    Im ersten Trimester reagiert der Embryo besonders empfindlich auf negative Umwelteinflüsse, denn in dieser Phase leiten viele Signalkaskaden nachfolgende Determinations-, Differenzierungs- und Entwicklungsprozesse ein. Je früher in der Schwangerschaft notwendige Veränderungen im Lebensstil oder in der Umwelt vorgenommen werden, umso besser.
  • Erläutern Sie, wie ein Neuron Informationen integriert, die es von mehreren anderen Neuronen erhält.

    Lösung

    Ein Neuron kann über Synapsen, die überall auf seinen Dendriten und seinem Zellkörper verteilt sind, exzitatorischen wie auch inhibitorischen Input empfangen. Die Summation dieser Inputs entscheidet darüber, ob das postsynaptische Neuron genügend depolarisiert wird, um zu feuern.
  • Erklären Sie, wie Astrocyten die synaptische Aktivität modulieren.

    Lösung

    Astrocyten können den Neurotransmitter wieder aufnehmen, der in den synaptischen Spalt ausgeschüttet wurde, und dadurch die postsynaptischen Antworten kontrollieren. Astrocyten können auch direkt Neurotransmitter freisetzen, die an Rezeptoren binden, um die Erregbarkeit eines Neurons zu beeinflussen.
  • Warum ergibt die Goldman-Gleichung ein exakteres Resultat für das Ruhepotenzial der Membran als die Nernst-Gleichung?

    Lösung

    Die Nernst-Gleichung berechnet das Membranpotenzial über der Membran, das durch die Bewegung eines bestimmten Ions durch diese Membran hervorgerufen wird, wenn die entsprechenden Konzentrationen des Ions auf beiden Seiten der Membran gegeben sind. Das dominante Ion für das Membranpotenzial ist K+, doch das K+-Gleichgewichtspotenzial, das die Nernst-Gleichung aufgrund der Kaliumkonzentrationen innen und außen ergibt, entspricht nicht dem gemessenen Membranpotenzial. Der Grund dafür ist, dass die Membran auch für andere Ionen eine gewisse Permeabilität aufweist und diese Ionen zum gemessenen Membranpotenzial beitragen. Die Goldman-Gleichung gibt das Membranpotenzial exakter an, weil sie alle Ionen berücksichtigt, die Konzentrationsunterschiede über der Membran aufweisen, und zudem die relativen Permeabilitäten der Membran für diese Ionen berücksichtigt.
  • Wie ermöglichen es graduierte Membranpotenziale der Aktivität im Axon eines Neurons, die verschiedenen dendritischen Inputs zu integrieren, welche dieses Neuron empfängt?

    Lösung

    Hemmende Inputs, die die Dendriten eines Neurons empfangen, führen zu einer Hyperpolarisation der Dendritenmembran, erregende Inputs zu einer Depolarisation. Diese Veränderungen des Membranpotenzials breiten sich bis zum Zellkörper des Neurons aus. Das resultierende Membranpotenzial des Zellkörpers ist ein graduiertes Membranpotenzial, weil es stets die Summe der dendritischen Inputs widerspiegelt. Dieses graduierte Membranpotenzial breitet sich wiederum zur Basis des Axonsaus, dem Axonhügel, der feuert, wenn sein Membranpotenzial das Schwellenpotenzial für die spannungsgesteuerten Natriumkanäle erreicht. Daher ist die Impulsfrequenz eine Funktion des graduierten Membranpotenzials des neuronalen Zellkörpers und damit eine Integration des gesamten dendritischen Inputs.
  • Warum ist ein Aktionspotenzial selbstregenerierend?

    Lösung

    Wenn sich die spannungsgesteuerten Natriumkanäle in einem Membranfleck öffnen, wird dieser Fleck depolarisiert. Diese lokale Depolarisation breitet sich elektrotonisch in benachbarte Membranregionen aus, sodass sie ihr Schwellenpotenzial erreichen, die spannungsgesteuerten Natriumkanäle sich öffnen und das Aktionspotenzial regenerieren. Dieser Prozess setzt sich über die ganze Länge des Axons fort.
  • Bei einem klinischen Test zur Messung der neuronalen Fortleitungsgeschwindigkeit wird ein Nerv an einer Stelle elektrisch gereizt und die Muskelreaktion an einer weiter entfernten Stelle abgeleitet. Warum wird dieser Test eingesetzt, wenn ein Arzt eine demyelinisierende Erkrankung vermutet?

    Lösung

    Wenn die Axone der Motoneuronen, die den Muskel stimulieren, demyelinisiert werden, sinkt die Fortleitungsgeschwindigkeit, was dazu führt, dass der Muskel länger braucht, um auf die elektrische Reizung zu reagieren.
  • Welche beiden Typen von Kationenkanälen gibt es in der motorischen Endplatte, und welche Funktionen haben sie?

    Lösung

    Die motorische Endplatte enthält sowohl liganden- als auch spannungsgesteuerte Natriumkanäle. Die ligandengesteuerten Kanäle reagieren auf den Neurotransmitter Acetylcholin, der die motorische Endplatte depolarisiert. Die spannungsgesteuerten Kanäle reagieren auf diese lokale Depolarisation, indem sie Aktionspotenziale generieren, die sich auf die benachbarte Muskelzellmembran ausbreiten.
  • Wie kann der gleiche Neurotransmitter auf einige postsynaptische Neuronen erregend, auf andere hemmend wirken?

    Lösung

    Die Wirkung eines Neurotransmitters hängt von den Rezeptortypen auf der postsynaptischen Membran ab, und sie können erregende oder hemmende Reaktionen im postsynaptischen Neuron auslösen.
  • Sarin ist eine farb- und geruchlose Flüssigkeit, die höchst tödlich ist. Es hemmt das Enzym Acetylcholinesterase irreversibel. Erklären Sie, warum Sarinopfer in der Regel ersticken.

    Lösung

    Atmen verlangt eine regelmäßige Aktivität der Motoneuronen, die die Atemmuskulatur kontrollieren. Die Hemmung von Acetylcholinesterase durch Sarin verhindert den Abfall des Acetylcholinspiegels im synaptischen Spalt zwischen den respiratorischen Motoneuronen und der Atemmuskulatur und verhindert so, dass diese Muskeln nach ihrer Kontraktion wieder erschlaffen. Sie krampfen also. Dadurch sind keine weiteren Atemzüge mehr möglich.
  • Erklären Sie, warum Bereiche des Nervensystems, die komplexe Informationen integrieren, in der Regel chemische statt elektrische Synapsen verwenden.

    Lösung

    Elektrische Synapsen sind schnell, integrieren Informationen aber nicht gut. Der Input an elektrischen Synapsen erlaubt keine zeitliche Summation, denn elektrische Synapsen brauchen für eine effiziente Übertragung eine große Kontaktfläche zwischen prä- und postsynaptischer Zelle; das beschränkt die Zahl der Synapsen, die zwischen zwei Neuronen ausgebildet werden können. Und schließlich können elektrische Synapsen keinen hemmenden Input liefern.
  • Was sind Ganglien, und warum sind sie am Vorderende vieler Wirbelloser konzentriert?

    Lösung

    Ganglien sind Ansammlungen von Nervenzellkörpern. Sie sind bei vielen Wirbellosen vor allem im Vorderende bzw. im Kopf zu finden, denn dort liegen zahlreiche Sinnesorgane und die Mundwerkzeuge
  • Wie kann ein und derselbe Reiz im Schaltkreis des Kniesehnenreflexes zur Kontraktion des einen Muskels und zur Erschlaffung des anderen Muskels führen?

    Lösung

    Beim Kniesehnenreflex kann derselbe Reiz durch eine exzitatorische Synapse zur Kontraktion eines Muskels und durch ein inhibitorisches Interneuron zur Erschlaffung des antagonistischen Muskels führen.
  • Wenn man Fische, dann Reptilien und schließlich Säuger betrachtet, welcher Teil des Gehirns nimmt am meisten an Größe zu?

    Lösung

    Der Teil des Wirbeltiergehirns, der sich von Fischen über Reptilien zu Säugern am stärksten vergrößert, ist der am weitesten vorn gelegene Teil, das Cerebrum.
  • Was erzeugt das Rezeptorpotenzial beim Dehnungsrezeptor des Flusskrebses? Wo und wie löst es ein Aktionspotenzial aus?

    Lösung

    Die mechanische Reizung der Dehnungsrezeptordendriten durch Dehnung des Muskels, den sie innervieren, führt zu einer graduierten Depolarisation im Zellkörper der Dehnungsrezeptorneuronen – dem Rezeptorpotenzial. Das Rezeptorpotenzial breitet sich zum Axonhügel aus. Wenn es die Membran des Axonhügels bis zur Schwelle depolarisiert, entsteht ein Na+-Aktionspotenzial, und die Zelle feuert.
  • Wie können wir Aktionspotenziale – die im Grunde letztlich alle gleich sind – als unterschiedliche Empfindungen wahrnehmen?

    Lösung

    Die Interpretation eines Aktionspotenzials hängt vom Zielneuron im Gehirn ab. Wenn das Aktionspotenzial in einen Nerv der Sehbahn einläuft, die in den visuellen Cortex (Sehrinde) projiziert, wird es als Licht gedeutet; ein ähnliches Aktionspotenzial, das in einen olfaktorischen Nerv einläuft, der in den Riechkolben projiziert, wird hingegen als Geruch interpretiert.
  • Pfeffersorten haben einen typischen Geschmack, doch sie können auch scharf sein, wenn sie das Molekül Capsaicin enthalten. Erklären Sie den Unterschied bei der Wahrnehmung des pfeffrigen Geschmacks und der Wahrnehmung der Pfefferschärfe.

    Lösung

    Die Moleküle, die für das typische Pfefferaroma verantwortlich sind, werden über Chemorezeptoren wahrgenommen, die eine G-Protein-gekoppelte Signalkaskade auslösen, welche Kationenkanäle in der Rezeptormembran öffnet. Capsaicin aktiviert jedoch direkt ein TRP-Protein, das auch als Thermosensor dient und dieses Protein ist selbst ein Kationenkanal, der sich öffnet, wenn er durch bestimmte Reize aktiviert wird.
  • Warum sindsensorische Adaptation oder das Fehlen sensorischer Adaptation wichtig für verschiedene sensorische Modalitäten?

    Lösung

    Die sensorische Adaptation ist die Fähigkeit eines sensorischen Systems, nicht länger auf ein konstantes Niveau rezeptorischer Reizung zu reagieren. Adaptation ist wichtig, wenn es darum geht, Reizveränderungen zu registrieren, ständige Information über den Reiz jedoch nicht nötig ist. Ein Beispiel ist die Aktivierung von Berührungsrezeptoren in der Haut durch Ihre Kleidung. Adaptation wäre nicht von Vorteil, wenn die Information entscheidend wichtig ist, zum Beispiel bei Schmerzempfinden, oder wenn eine ständige Information nötig ist, wie im Fall der sensorischen Neuronen, die den Muskeltonus der Haltemuskulatur kontrollieren.
  • Unterschiedliche Duftstoffmoleküle tragen unterschiedliche Rezeptoren auf der Zelloberfläche, doch diese Zellen aktivieren den gleichenintrazellulären G-Protein gekoppelten Signalweg. Wie unterscheidet das olfaktorische System verschiedene Gerüche?

    Lösung

    Olfaktorische Neuronen, die die gleichen Rezeptoren exprimieren, projizieren auf die gleichen Glomeruli im Bulbus olfactorius. Daher hängt die Identifizierung eines bestimmten Duftstoffs vom Verknüpfungsmuster der aktivierten olfaktorischen Neuronen ab.
  • Wie unterscheidet das olfaktorische System zwischen einem fast verwehten und einem frisch abgesetzten Stinktiergeruch und dem Geruch von Stinktierkohl (einem Aronstabgewächs)?

    Lösung

    Ein olfaktorisches System signalisiert die Intensität eines Reizes – Hauch einen Geruchs versus widerwärtigen Gestank – durch seine Impulsfrequenz. Die Unterscheidung zwischen einem Stinktier und einem Stinkkohl hängt von der Mischung der Duftstoffmoleküle ab.
  • Die Konzentrationsschwellen für die Wahrnehmung von Bitterstoffen liegen niedriger als diejenigen für Salziges oder Süßes. Bieten Sie eine evolutionsbiologische Erklärung dafür an, warum das so ist.

    Lösung

    Was Salz angeht, so weisen extrazelluläre Flüssigkeiten wie Speichel eine hohe Kochsalzkonzentration auf, daher ist eine geringere Sensitivität angebracht, um Konzentrationen oberhalb des Grundniveaus zu registrieren. Was Süße angeht, so gab es einen evolutionären Druck, zwischen Nahrung mit hohem und mit niedrigen Energiegehalt zu unterscheiden. Eine geringe Empfindlichkeit fördert die Auswahl energiereicherer Nahrung. Bittergeschmack ist ein Merkmal vieler Verbindungen, die der Abwehr von Fressfeinden dienen und daher giftig sind; daher hilft eine hohe Sensitivität, eine Vergiftung zu vermeiden.
  • Wie können wir mit nur fünf Kategorien von Geschmacksrezeptoren so viele verschiedene Geschmackseindrücke unterscheiden?

    Lösung

    Mit nur fünf Kategorien von Geschmacksrezeptoren können wir ein breites Spektrum von Geschmacksrichtungen wahrnehmen, weil erstens die Kategorien jeweils über zahlreiche unterschiedliche Rezeptorgene verfügen, zweitens ein Stoff mehrere Rezeptorkategorien ansprechen und daher ein gemischtes Signal erzeugen kann, und drittens Informationen von Geschmacksrezeptoren mit Informationen von Geruchsrezeptoren wie auch von Thermorezeptoren (TRP-Kanälen) und taktilen Rezeptoren integriert wird.
  • Warum gibt es unterschiedliche Typen von mechanorezeptiven Zellen, die unterschiedliche Adaptationsraten aufweisen?

    Lösung

    Unterschiedliche Typen von Mechanorezeptoren ermöglichen Reaktionen auf unterschiedliche Aspekte einer Berührung, zum Beispiel Intensität, Textur, Druck, Vibration und Jucken. Unterschiedliche Adaptationsraten bei Berührungsrezeptoren ermöglichen es, zwischen Reizen zu diskriminieren, die relevant sind, und solchen, die es nicht sind. Langsam adaptierende Mechanorezeptoren wie diejenigen in der Haltemuskulatur liefern kontinuierlich Informationen. Rasch adaptierende Mechanorezeptoren liefern Informationen über sich verändernde Bedingungen und verbessern zudem die sensorische Fähigkeit zur räumlichen und zeitlichen Auflösung von Reizen.
  • Erklären Sie die Rolle von spezifischen Mechanorezeptoren, wenn Sie a) ein Glas Wasser halten, das gefüllt wird, und b) ein schweres Möbelstück heben.

    Lösung

    Die Aktivität einer Muskelspindel erhöht die Aktivität des Motoneurons, das den entsprechenden Muskel innerviert. Die funktionelle Bedeutung dieser Dehnungsrezeptoren besteht darin, dass sie eine ständige Anpassung an wechselnde Muskelbelastungen erlauben, zum Beispiel, wenn Sie ein Glas halten, das gefüllt wird. Die Aktivität im Golgi-Sehnenorgan hemmt die Aktivität in dem Muskel, der die Dehnung dieses Golgi-Sehnenorgans auslöst. Die funktionelle Bedeutung besteht darin, einer Schädigung von Muskel und Sehnen durch das Erzeugen einer zu hohen mechanischen Spannung vorzubeugen, zum Beispiel, wenn man versucht, zu schwere Gegenstände zu heben.
  • Wie führen unterschiedliche Schallfrequenzen dazu, dass Aktionspotenziale in unterschiedlichenHörnervenfasern ausgelöst werden?

    Lösung

    Unterschiedliche Schallfrequenzen führen zu unterschiedlichen Auslenkungsfrequenzen des Trommelfells, und diese Bewegungen werden von den Gehörknöchelchen im Mittelohr weitergeleitet, verstärkt und in Schwingungen des ovalen Fensters zum flüssigkeitsgefüllten Innenohr übersetzt. Diese Schwingungen erzeugen Druckwellen in der Flüssigkeit des Innenohrs. Diese Flüssigkeit umgibt die Basilarmembran im Vorhof- und im Paukengang. Die Dicke der Basilarmembran nimmt vom proximalen Ende des Kanals zum distalen Ende hin ab. Druckwellen unterschiedlicher Frequenz in der Flüssigkeit des Paukengangs bewirken, dass die Basilarmembran an verschiedenen Stellen in Schwingung gerät. Die Haarzellen liegen auf der Basilarmembran; daher werden durch Druckwellen unterschiedlicher Frequenz unterschiedliche Gruppen von Haarzellen aktiviert.
  • Erklären Sie, warum sich ein Komplexauge besser für die Wahrnehmung von Bewegung eignet als für das Erstellen von scharfen Bildern.

    Lösung

    Ommatidien eignen hervorragend zur Bewegungswahrnehmung, denn sich bewegende Objekte in einem Sehfeld schalten benachbarte Ommatidien an und ab. Da jedes Ommatidium jedoch nur Licht von einem kleinen, aber separaten Teil des gesamten Sehfelds erhält, entstehen lediglich gepixelte Bilder mit geringer Auflösung.
  • Wie verändert ein Photon (Lichtquant) das Membranpotenzial der Stäbchen?

    Lösung

    Wenn Photonen Rhodopsin anregen, verändert sich dessen Konformation, und das aktiviert ein G-Protein, das seinerseits eine Phosphodiesterase aktiviert, die cGMP in GMP umwandelt. Das Absinken der cGMP-Konzentration veranlasst die cGMP-gesteuerten Natriumkanäle, sich zu schließen, was den Dunkelstrom reduziert. Na+ wird auch aus dem proximalen Ende des Photorezeptors gepumpt, dessen Membranpotenzial hyperpolarisiertwird.
  • Erklären Sie, wie sich Stäbchen und die verschiedenen Zapfentypen in ihrer spektralen Empfindlichkeit unterscheiden.

    Lösung

    Stäbchen und die verschiedenen Zapfentypen haben unterschiedliche spektrale Empfindlichkeiten, weil sie über jeweils leicht andere Opsine verfügen. Der Bau des Opsins bestimmt, welche Lichtwellenlänge eine Zelle absorbiert und wie sie ihr assoziiertes 11-cis-Retinal aktiviert.
  • Wenn Sie direkt geradeaus schauen und jemand eine farbige Karte an Ihrer rechten oder Ihrer linken Seite hoch hält, warum können Sie nicht sagen, um welche Farbe es sich handelt?

    Lösung

    Sie können in der Peripherie Ihres Sehfelds keine Farben erkennen, weil sich die Zapfen in der Fovea centralis konzentrieren, auf die nur Licht aus dem Zentrum des Sehfelds fällt. Stäbchen sind nicht farbtüchtig und im Randbereich der Netzhaut häufiger.
  • Geben Sie zwei Gründe dafür an, warum Ihr Sehvermögen beeinträchtigt ist, wenn Sie aus dem Hellen in einen schwach beleuchteten Raum treten.

    Lösung

    Zwei Gründe, warum man im ersten Moment schlecht sieht, wenn man aus dem Hellen in einen schwach erleuchteten Bereich tritt, sind, dass helles Licht viele Rhodopsinmoleküle bleicht und dass die Amakrinzellen den Bereich der Lichtempfindlichkeit der Netzhaut neu anpassen müssen. Ein dritter Grund ist, dass die Pupillenweite noch auf die hellere Umgebung eingestellt ist.
  • Nennen Sie vor dem Hintergrund dessen, was Sie über afferente und efferente Systeme wissen, die im Nervensystem operieren, Beispiele für Rückkopplungsschleifen zwischen Gehirn und Körper, die folgendes Verhalten beeinflussen:
    a. Willkürverhalten durch einen bewusst wahrgenommenen sensorischen Reiz
    b. unwillkürliche Reaktionen durch einen bewusst wahrgenommenen sensorischen Reiz
    c. unwillkürliche Reaktionen durch einen nicht bewusst wahrgenommenen Reiz

    Lösung

    a. Der bewusste sensorische (afferente) Reiz, eine Giftschlange zu sehen, löst im ZNS bewusste Kommandos an die Beinmuskulatur (efferenter Output) aus, um sich aus der Gefahrenzone zu entfernen.
    b. Der bewusste sensorische Reiz, den der Duft von frisch gebackenem Brot darstellt, kann eine autonome Reaktion auslösen, nämlich Speichelfluss und verstärkte Magenbewegung.
    c. Der unbewusste Reiz, den ein Absinken des Blutdrucks darstellt, kann einen unwillkürlichen Befehl auslösen, die Herzschlagrate zu erhöhen.
  • Bei Anencephalie, einer tödlichen Entwicklungsstörung, schließt sich die vorderste Region des sich entwickelnden Neuralrohrs nicht.Erklären Sie, wie sich dies auf die Entwicklung spezifischer Hirnstrukturen auswirkt.

    Lösung

    Wenn sich das Vorderende des embryonalen Neuralrohrs nicht schließt, wirkt sich dies am stärksten auf das Telencephalon aus und führt dazu, dass sich das Großhirn nicht entwickelt.
  • Die Größe des menschlichen Gehirns liegt deutlich über der Regressionsgeraden für die Gehirngröße als Funktion der Körpergröße bei Säugern. Warum reichtdiese Beobachtung nicht, den Unterschied der cerebralencortikalen Kapazität des Menschen im Vergleich zu anderen Säugern zu bewerten?

    Lösung

    Der Vergleich der cortikalen Kapazität des Menschen mit derjenigen anderer Säuger kann nicht nur auf der Gehirngröße basieren, denn der menschliche Cortex ist stark gefaltet und weist daher eine größere Fläche auf. Ein höherer Prozentsatz des menschlichen Cortex ist assoziativen Funktionen gewidmet (Assoziationscortex), die die Cortexkapazität erhöhen.
  • ErläuternSie, wie eine Schnittwunde an der linken Halsseite zu einer Pupillenverengung im linken Auge führen kann.

    Lösung

    Eine Messerwunde an der linken Seite des Halses könnte die sympathische Ganglienkette (Grenzstrang) an dieser Seite schädigen. Das könnte die Verbindung zwischen dem prä- und dem postganglionären sympathischen Neuron unterbrechen, die die Pupille des linken Auges innervieren, und so zu einer Pupillenverengung führen (da der intakte Sympathicus die Pupille erweitert).
  • Warum kann ein kleiner Lichtfleck auf der Retina eine stärkere Antwort in einer retinalen Ganglienzelle hervorrufen als ein großer Lichtfleck, der in denselben Bereich der Retina fällt?

    Lösung

    Ein kleiner Lichtfleck auf der Retina kann nur das On-Zentrum des rezeptiven Felds einer Ganglienzelle illuminieren und sie daher maximal erregen. Ein großer Lichtfleck würde Rezeptorzellen rund um das On-Zentrum beleuchten, die hemmend wirken und daher die Aktivität senken, die durch die Beleuchtung des Zentrums dieses rezeptiven Feldes ausgelöst wird.
  • Wie würde sich das Sehen verändern, wenn das Chiasma opticum in der Mittellinie durchtrennt würde?

    Lösung

    Wenn das Chiasma opticum genau in der Mittellinie durchtrennt würde, würden die Axone der Ganglienzellen den mittleren Hälften der Netzhaut nicht auf die gegenüberliegende Seite des Gehirns kreuzen. Daher würde das linke Auge Dinge im linken Sehfeld nicht sehen und das rechte Auge würde Dinge im rechten Sehfeld nicht sehen. Ohne Input von beiden Augen gäbe es keine Binokularzellen und daher keine Tiefenwahrnehmung.
  • Welche Bedeutung hat die Lähmung der Skelettmuskulatur im REM-Schlaf?

    Lösung

    Eine Lähmung der Skelettmuskulatur im REM-Schlaf verhindert, dass jemand in der Traumphase seine Träume physisch auslebt, indem er um sich schlägt oder schlafwandelt.
  • Wie kann eine Person mit einem durchtrennten Corpus callosum, der man ein Objekt in ihrem linken Gesichtsfeld zeigt, einem Beobachter mitteilen, um was für ein Objekt es sich handelt?

    Lösung

    Jemand mit einem durchtrennten Corpus callosum könnte ein Objekt in seinem linken Sehfeld nicht mit Worten beschreiben, aber er könnte es zeichnen oder auf ein ähnliches Objekt auf einem Bild zeigen.
  • Was sagt uns der Fall H. M. über die Hirnmechanismen, die dem Erwerb von deklarativen Erinnerungen zugrunde liegen?

    Lösung

    Aus der Beobachtung, dass H. M. zum unmittelbaren Erinnern in der Lage war, aber keine deklarativen Langzeiterinnerungen speichern konnte, kann man schließen, dass der Hippocampus für den Erwerb neuer deklarativer Erinnerungen und deren Überführung ins Langzeitgedächtnis notwendig ist.
  • Was ist so einzigartig am Inselcortexhöherer Säuger, dass es die Evolution von Bewusstsein erklären könnte?

    Lösung

    Menschen, Große Menschenaffen, Elefanten und einige Meeressäuger verfügen über einen ausgedehnten Inselcortex, der physiologische Informationen aus dem ganzen Körper wie auch soziale und emotionale Informationen integriert und daher möglicherweise ein Gefühl für das eigene Ich (Ich-Bewusstsein) erzeugt.
  • Bedenken Sie die Anordnung der Actin- und Myosinfilamente im Sarkomer. Warum werden die H-Zone und die I-Bande kleiner, wenn sich der Skelettmuskel kontrahiert, und warum verändert sich die A-Bande nicht?

    Lösung

    Ein Sarkomer wird von den Z-Scheiben begrenzt und besteht aus überlappenden Actin- und Myosinfilamenten. Die Actinfilamente sind an den Z-Scheiben verankert und reichen nicht bis in die Mitte des Sarkomers. Die Myosinfilamente sind an der M-Linie in der Mitte des Sarkomers verankert, erstrecken sich aber nicht bis zu den Z-Scheiben. Deshalb gibt es Regionenwie die I-Bande und die H-Zone, in denen die Actin- und Myosinfilamente nicht überlappen. Wenn sich der Muskel und somit das Sarkomer kontrahiert, bewegen sich die Myosinfilamente entlang den Actinfilamenten auf die Z-Scheiben zu. Deshalb verschmälert sich die I-Bande. Gleichzeitig bewegen sich die Actinfilamente auf die M-Linie zu, sodass sich auch die H-Zone verschmälert.
  • Welche Rolle spielen die drei Untereinheiten des Toponins bei der Steuerung der Skelettmuskelkontraktion?

    Lösung

    Eine der Troponinuntereinheiten verankert sich am Tropomyosinstrang. Eine andere Troponinuntereinheit bindetan das Actinfilament. Die dritte Untereinheit bindet Ca2+. Die Bindung von Ca2+ bewirkt eine Konformationsänderung des Troponins, die dazu führt, dass der Tropomyosinstrang von der Myosinnindungsstelle am Actin weggezogen wird. Der Actomyosinkomplex führt dazu, dass sich das Sarkomer kontrahiert.
  • Warum tritt die Totenstarre (Rigor mortis) zuerst in denjenigen Muskeln auf, in denen am wenigsten Glykogen gespeichert ist?

    Lösung

    Die Totenstarre tritt ein, weil kein ATP mehr vorhanden ist, das nötig wäre, um die Bindung zwischen den Actinfilamenten und den Myosinköpfen zu trennen. Wenn beim Tod Atmung und Kreislauf zum Stillstand kommen, werden die Muskeln nicht mehr mit Sauerstoff und Glucose aus dem Blut versorgt, sodass keine ATP-Bildung durch den oxidativen Stoffwechsel mehr stattfinden kann. Ein wenig ATP kann jedoch noch durch den anaeroben Stoffwechsel gebildet werden. Die Muskeln, in denen das meiste Glykogen gespeichert ist, können den anaeroben Stoffwechsel am längsten aufrechterhalten.
  • Das Insektizid Malathion zerstört die Funktion des Enzyms Acetylcholinesterase. Ist man ihm als Mensch unbeabsichtigt ausgesetzt, kann dies ausgeprägte Muskellähmung verursachen. Weshalb?

    Lösung

    Indem es die Funktion der Acetylcholinesterase zerstört, verhindert Malathion den Abbau von Acetylcholin, das an den motorischen Endplatten freigesetzt wird. Dies führt zu einer andauernden, starken Erregung der Muskelzellen durch die motorischen Endplatten. Aktionspotenziale werden kontinuierlich an den Muskelzellmembranen generiert, sodass ständig Ca2+ in das Cytosol freigesetzt wird. Deshalb bilden sich anhaltend Querbrücken zwischen den Actin- und Myosinfilamenten aus.
  • Warum sind Gap Junctions wichtig für die Funktion der Herz- und der glatten Muskulatur, aber nicht für die der Skelettmuskulatur?

    Lösung

    Gap Junctions machen es möglich, dass Schichten aus Herzmuskelzellen oder glatten Muskelzellen als Einheit kontrahieren. Auf diese Weise arbeiten Herzmuskelzellen zusammen, um Blut zu pumpen. Auch glatte Muskelzellen arbeiten zusammen, wenn sie beispielsweise den Nahrungbrei durch den Darm fortbewegen. Weil Skelettmuskelfasern einzeln kontrolliert werden, können mit der Skelettmuskulatur fein abgestimmte, komplexe Bewegungen ausgeführt werden.
  • Wie kann das Nervensystem steuern, welche Kraft ein Muskel generiert? Bedenken Sie dabei das Zusammenwirken von Motoneuronen und Skelettmuskulatur.

    Lösung

    Ein Skelettmuskel besteht aus vielen Muskelfasern. Jede Muskelfaser wird von einem Motoneuron innerviert, aber ein Motorneuron kann Synapsen mit vielen Muskelfasern bilden. Alle Fasern, die von einem einzigen Motoneuron aktiviert werden, bilden eine motorische Einheit. Das Nervensystem kann die Frequenz der Aktionspotenziale einer motorischen Einheit verändern und die Zahl der motorischen Einheiten erhöhen, die im gleichen Muskel aktiviert werden.
  • Warum haben Haltungsmuskeln einen höheren prozentualen Anteil an langsamen Fasern als Muskeln, die beim Sprinten eingesetzt werden?

    Lösung

    Haltungsmuskeln müssen über lange Zeit ständig kontrahiert sein, aber sie werden im Allgemeinen nicht für schnelle, kraftvolle Bewegungen eigesetzt.
  • Erläutern Sie Beobachtungen zur körperlichen Leistung des Menschen auf der Grundlage Ihres Wissens über die drei Systeme, die die Muskeln mit ATP versorgen.

    Lösung

    Energie für einen Sprint liefert in erster Linie bereits gebildetes ATP und Kreatinphosphat, zudem stellt die Glykolyse Energie bereit. Diese ATP-Quellen können schnell mobilisiert werden. Bei einem 10-Kilometer-Lauf muss ATP durch oxidativen Energiestoffwechsel gebildet werden. Dies erfordert den Transport von Sauerstoff und deutlich mehr enzymatische Reaktionen. Es dauert länger, ATP bereitzustellen, und auf diese Weise kann keine hohe Arbeitsleistung erbracht werden.
  • Weshalb ist die Häutung ein universelles Merkmal der Arthropoden, nicht aber der Vertebraten?

    Lösung

    Arthropoden besitzen ein Exoskelett und müssen es, wenn sie wachsen,mittels Häutung abstoßen und durch ein größeres ersetzen.
  • Astronauten bauen Knochenmasse ab, wenn sie lange Zeit in der Internationalen Raumstation ISS verbringen.Wie verändert sich die Aktivität ihrer Knochenzellen dabei vermutlich, und welche Mechanismen im Knochen könnten dem zugrunde liegen?

    Lösung

    Weil Astronauten Knochenmasse abbauen, kann man annehmen, dass sich die Aktivität ihrer Osteoklasten verstärkt, während die Osteoblasten weniger aktiv sind. Möglicherweise geht dies auf eine veränderte Aktivität ihrer Osteocyten zurück, denn in der Schwerelosigkeit wirkt das Körpergewicht nicht als Stressor auf die Knochen.
  • Beim Kiefergelenk ist der Kraftarm im Verhältnis zum Lastarm länger als beim Ellbogengelenk.Wie wirkt sich dies aus?

    Lösung

    Ist der Kraftarm eines Gelenks im Verhältnis zum Lastarm lang, kann es größeren Druck generieren. Ist der Kraftarm im Verhältnis zum Lastarm kurz, kann sich das Ende des Lastarms über eine große Distanz sehr schnell bewegen, aber das Gelenk kann nicht viel Druck ausüben. Der Kiefer kann großen Druck über eine kleine Distanz ausüben, weil der Kraftarm im Verhältnis zum Lastarm relativ lang ist. Dank unseres Ellbogengelenks können wir den Unterarm schnell über eine große Distanz bewegen, aber keinen großen Druck ausüben, denn der Kraftarm ist im Verhältnis zum Lastarm kurz.
  • Wie hoch ist der Sauerstoffpartialdruck eingeatmeter Luft auf Meeresspiegelhöhe, in 2000 m Höhe über dem Meeresspiegel, wo der Luftdruck 80 % des Luftdrucks auf Meeresspiegelhöhe beträgt, und eingeatmeter Luft in 10 m Wassertiefe, die denselben Druck wie die Umgebung hat (= 1  barzusätzlich)?

    Lösung

    Auf Meeresspiegelhöhe und bei einem angenommenen normalen Luftdruck von 760 mmHg beträgt der pO2 20,9 % von diesem Wert, also 159 mmHg. Deshalb beträgt der pO2 in 2000 m Höhe 127 mmHg. Wenn wir Luft mit dem zweifachen Druck des Luftdrucks atmen, beträgt der pO2 318 mmHg.
  • Plattwürmer sind Wirbellose, die keine speziellen Atemorgane besitzen. Welche beiden Komponenten des Fick‘schen Diffusionsgesetzes ermöglichen es diesen Tieren, ihren Sauerstoffbedarf über die Haut zu decken?

    Lösung

    Der Körper eines Plattwurms ist stark abgeflacht. Deshalb befinden sich alle Zellen des Körpers so nahe an der Umgebung, dass O2 und CO2 direkt von den Zellen in die Umgebung diffundieren können und umgekehrt. Die beiden Komponenten des Fick‘schen Diffusionsgesetzes, die diese anatomischen Merkmale betreffen, sind eine große Austauschfläche, durch die die Gase diffundieren, und eine minimale Diffusionsstrecke.
  • Der O2-Gehalt des Wassers nimmt mit steigender Wassertemperatur ab, aber die Kiemenventilationsrate von Fischen nimmt viel stärker zu als es nötig wäre, um die geringere O2-Verfügbarkeit zu kompensieren. Weshalb?

    Lösung

    Wenn die Wassertemperatur steigt, sinkt der O2-Gehalt des Wassers (die O2-Löslichkeit nimmt mit steigender Temperatur ab). Weil die Körpertemperatur des Fisches aber im Gleichgewicht mit der Wassertemperatur steht, nimmt seine Stoffwechselrate zu (Q10-Effekt). Deshalb muss der Fisch seine Kiemen stärker ventilieren, um seinen O2-Bedarf zu decken. Diese Arbeit steigert seinen O2-Bedarf jedoch noch mehr.
  • Wie unterscheidensich die Diffusionsraten beim Austausch von O2 und CO2 auf Meeresspiegelhöhe und im Hochgebirge? Ziehen Sie das Fick‘sche Diffusionsgesetz heran.

    Lösung

    Wenn man sich von Meeresspiegelhöhe ins Hochgebirge begibt, nimmt der Sauerstoffpartialdruck der eingeatmeten Luft ab. Der flachere Partialdruckgradient bewirkt, dass weniger O2 in den Körper diffundiert. Weil der Kohlenstoffdioxidpartialdruck auf Meeresspiegelhöhe extrem niedrig ist, sinkt er mit zunehmender Höhe nicht signifikant ab. Deshalb verändert sich der Partialdruckgradient für aus dem Körper in die Lunge diffundierendes CO2 nicht.
  • Wie kann sich (bei konstanten Raten von Ventilation und Perfusion) die Strömungsrichtung von Blut und Wasser an den Kiemenlamellen von Fischen darauf auswirken, wie viel O2 maximal aufgenommen werden kann?

    Lösung

    Wenn Ventilation (Wasser) und Perfusion (Blut) der Kiemen in derselben Richtung geschehen (gleiche Strömungsrichtung), erreicht der Prozentsatz der Sauerstoffsättigung von Blut und Wasser irgendwo zwischen der maximalen O2-Konzentration des ankommenden Wassers und der O2-Konzentration des ankommenden Blutes ein Gleichgewicht. Bei entgegengesetzt gerichteter Strömungsführung ist es möglich, dass die Sauerstoffsättigung des Blutes, das aus den Kiemen strömt, fast der Sauerstoffsättigung des Wassers entspricht, das in die Kiemen strömt.
  • Wie halten Vögel einen konstanten, unidirektionalen Luftstrom durch ihre Lungen aufrecht?

    Lösung

    Ein wichtiges Merkmal der Vogellunge sind die Parabronchien, die es ermöglichen, dass Luft unidirektional durch die Lunge strömt. Wenn ein Vogel einatmet, strömt die Luft in die hinteren Luftsäcke. Bei der nächsten Exhalation durchströmt die Frischluft die Parabronchien. Die folgende Inhalation führt dazu, dass Luft aus der Lunge in die vorderen Luftsäcke strömt, während neue Fischluft in die hinteren Luftsäcke gelangt. Bei der nächsten Exhalation wird die Luft aus den vorderen Luftsäcken wieder in die Umgebung abgegeben, während die Luft aus den hinteren Luftsäcken in die Lunge strömt. Die Durchströmung der Parabronchien und die blasebalgähnliche Funktion der Luftsäcke gewährleisten eine ständige unidirektionale Durchströmung der Vogellunge.
  • Ermitteln Sie diefunktionelle Residualkapazitäteiner Person, die aus einem Spirometer mit einem Reservoirvolumen von 30 l atmet. Anfangs setzt sich das Gasgemisch aus 20 % O2, 75 % Stickstoff (N) und 5 % Helium (He) zusammen. Die Person beginnt mit einer Inhalation und atmet 20-mal ein und aus. Danach beträgt die Heliumkonzentration im Spirometer 4,6 %.

    Lösung

    Der Anteil von Helium (He) im System bleibt gleich, es wird aber gleichmäßig im Spirometer und in der Lunge verteilt. Der anfängliche Heliumanteil ist 0,05 × 30 l = 1,5 l. Der Heliumanteil zum Ende beträgt ebenfalls 1,5 l, aber diese sind auf die 30 l und die FRC der Person verteilt.
    Deshalb gilt:
  • Weshalb haben mache Frühgeborene Schwierigkeiten beim Atmen?

    Lösung

    MancheFrühgeborene kommen zur Welt, bevor bestimmte Zellen in ihren Alveolen ein Surfactant bilden. Fehlt das Surfactant, ist zusätzliche erhebliche Kraftanstrengung nötig, um beim Einatmen die Oberflächenspannung des Flüssigkeitsfilms zu überwinden, der die Alveolen innen auskleidet.
  • Weshalb führt eine Stichwunde in die Brusthöhle zu einem Pneumothorax (Lungenkollaps)?

    Lösung

    Zwischen den Pleurablättern besteht immer eine Spannung, weil der Brustkorb nach außen und die Eigenelastizität des Lungengewebes nach innen ziehen. Diese Spannung bewirkt, dass die Lunge zwischen den Atemzügen teilweise gebläht bleibt. Eine Stichwunde in die Thoraxhöhle lässt Luft zwischen die Pleurablätter eindringen, sodass sich der Druck dem äußeren Luftdruck angleicht. Deshalb kann die teilweise Blähung der Lunge nicht mehr aufrechterhalten werden.
  • Wie ist während des Atemzyklus der Druck in den Alveolen, wenn die Spannung zwischen den Pleurablättern maximal ist? Erläutern Sie Ihre Antwort.

    Lösung

    Die Spannung zwischen den Pleurablättern ist am Höhepunkt der Inhalation maximal, denn das Lungengewebe wird maximal gedehnt. Wenn die Lunge gefüllt ist, strömt keine Luft mehr und der Druck in den Alveolen entspricht dem Luftdruck.
  • Der pO2 der Luft auf Meeresspiegelhöhe beträgt etwa 159 mmHg. Welche Bedeutung hat die Tatsache, dass menschliches Hämoglobin bei einem pO2 von 100 mmHg vollständig mit O2 gesättigt ist und im venösen Blut mit einem pO2 von etwa 40 mmHg zum Herzen zurückkehrt, also mit einer Sättigung von 75 %?

    Lösung

    Weil die Luft sich in den Alveolen mit Totraumluft vermischt, beträgt der maximale pO2 etwa 100 mmHg, und Hämoglobin ist bei diesem pO2 vollständig gesättigt. Da gemischtvenöses Blut normalerweise zu 75 % gesättigt zum Herzen zurückkehrt, verfügt das Blut, wenn es durch ein sehr stoffwechselaktives Gewebe fließt, über eine O2-Reserve, die es abgeben kann, um einen lokal hohen Bedarf zu decken.
  • Wenn Erythrocytenin einer Blutbank gelagert werden, nutzen sie nach einer gewissen Zeit ihr 1,3-DPG zur Energiegewinnung. Wie wirkt sich dies auf ihre Funktionsfähigkeit nach einer Bluttransfusion aus?

    Lösung

    Wenn die Konzentration von 1,3-DPG in den gelagerten Erythrocyten abnimmt, nimmt auch die Konzentration von 2,3-DPG ab, das durch Umwandlung von 1,3-DPG gebildet wird. Deshalb verschiebt sich die O2-Bindungskurve bzw. die O2 -Dissoziationskurve des Hämoglobins nach links. Daher ist das O2 stärker an das Hämoglobin gebunden und wird nicht freigesetzt, um für die Zellatmung zur Verfügung zu stehen.
  • Warum verlassen HCO3--Ionen die Erythrocytenim systemischen venösen Blut, treten aber im Kapillarnetz um die Alveolen in die Erythrocytenein?

    Lösung

    Die Umwandlung von CO2 zu H2CO3- und dann zu HCO3- ist eine reversible Gleichgewichtsreaktion, die von den Konzentrationen der Reaktanden und Produkte abhängig ist. In den atmenden Geweben ist der pCO2 hoch und verschiebt die Reaktion in den Erythrocytenin Richtung HCO3-, das im Austausch für Cl- ins Blutplasma gelangt.In den Alveolen ist der pCO2 niedrig; deshalb laufen die Reaktionen umgekehrt ab. Das bedeutet, dass die Diffusion von CO2 aus den Erythrocytendazu führt, dass HCO3- zurück in die Erythrocytengelangt, wo es wieder in H2CO3und dann in CO2 umgewandelt wird.
  • Welche Veränderungen treten bei den respiratorischen Motoneuronen und den an der Atmung beteiligten Muskelgruppen ein, wenn man von der Atmung in Ruhe übergeht zu einer Atmung, bei der ein größerer Teil der Vitalkapazität der Lunge genutzt wird?

    Lösung

    Während der bidirektionalen Atmung feuert eine Gruppe respiratorischer Motoneuronen in der dorsalen Medulla oblongata in einem regelmäßigen zyklischen Muster, was zu Zwerchfellkontraktionen führt. Ist ein erhöhter Atemgasaustausch nötig, steigt die Feuerrate dieser respiratorischen Motoneuronen. Steigt der Bedarf weiter an, wird eine Gruppe respiratorischer Motoneuronen in der ventralen Medulla oblongata herangezogen. Dies hat Kontraktionen der Zwischenrippenmuskulatur zur Folge. So wird das Atemvolumen erhöht, das mit jedem Atemzug ausgetauscht wird.
  • Wenn Sie schnell ins Hochgebirge aufsteigen, verändert sich möglicherweise Ihr Atemmuster: Phasen, in denen Sie gar nicht atmen, wechseln sich mit Phasen ab, in denen Sie rasch atmen. Erklären Sie dieses zyklische Atemmuster. Bedenken Sie dabei die Diffusionsgradienten für O2 und CO2 und die Feedback-Signale, die die Atmung regulieren.

    Lösung

    Wenn Sie einen hohen Berg besteigen, nimmt der Diffusionsgradient für O2 ab, weil der Luftdruck geringer wird. Der Diffusionsgradient für CO2 verändert sich jedoch nicht. Der CO2 -Gehalt der Umgebung ist sowohl auf Meeresspiegelhöhe als auch in großen Höhenlagen nahe null. Weil die Atmung einen größeren O2 -Bedarf decken muss, führt dies zu einer höheren CO2 -Abgabe als auf Meeresspiegelhöhe. Da CO2 der wichtigste Stimulus für die Atmung ist, verlangsamt sich die Atmung oder setzt aus, bis der pCO2 wieder einen Wert erreicht hat, der die Atmung stimuliert.
  • Zellen der Gewebeknoten auf den Halsschlagadern und der Aorta haben hohe Stoffwechselraten und reagieren sensitiv auf eine schlechtere Durchblutung und auf einen Abfall des pO2 des Blutes. Wie hängen diese beiden Faktoren miteinander zusammen?

    Lösung

    Weil die Stoffwechselrate der Gewebeknoten auf den Halsschlagadern und der Aorta hoch ist, werden sie beeinträchtigt, wenn sie nicht mehr so gut mit O2 versorgt werden, gleich, ob dies auf abnehmende Durchblutung oder einen geringeren pO2 des Blutes zurückzuführen ist.
  • Beschreiben Sie, wie Kreislaufsysteme die Muskelarbeit unterstützen.

    Lösung

    Kreislaufsysteme versorgen Muskelzellen, die Arbeit verrichten, mit Sauerstoff und Nährstoffen. Außerdem führen sie CO2 und Wärme ab.
  • Ein Schwamm ist weder klein noch dünn. Wie kann er ohne Kreislaufsystem leben?

    Lösung

    Über Poren mit der Außenwelt in Verbindung stehende Hohlräume durchziehen die Gewebe eines Schwamms. Das bedeutet, dass das äußere Medium Wasser in die Nähe aller Zellen gelangt, sodass der Austausch von Nährstoffen, Sauerstoff und Abfallprodukten stattfinden kann.
  • Erläutern Sie die Bedeutung extrazellulärer Flüssigkeit bei großen, mobilen Tieren.

    Lösung

    Hämolymphe ist die extrazelluläre Flüssigkeit von Tieren mit einem offenen Kreislaufsystem. Bei Tieren mit einem geschlossenen Kreislaufsystem ist das Blutplasma die extrazelluläre Flüssigkeit innerhalb des Kreislaufsystems. Die interstitielle Flüssigkeit ist die extrazelluläre Flüssigkeit außerhalb des Kreislaufsystems. Blut enthält neben dem Plasma auch Blutzellen.
  • Wie unterstützt ein geschlossenes Kreislaufsystem die Kampf-oder-Flucht-Reaktion?

    Lösung

    Bei der Kampf-oder-Flucht-Reaktion findet ein vermehrter Blutstrom zu Geweben und Organen statt, die für diese Reaktion notwendig sind, wie zu den Skelettmuskeln. Der Blutstrom zu Geweben, die bei dieser Reaktion nicht gebraucht werden, wie dem Darm, ist vermindert. Ein geschlossenes Kreislaufsystem kann den Blutstrom verstärken, indem es den Druck erhöht. Es kann außerdem den Blutstrom gezielt zu bestimmten Geweben leiten, indem es den Widerstand der Gefäße verändert, die zu diesen Geweben führen.
  • Erläutern Sie den Blutstrom im Kreislaufsystem eines Fisches.

    Lösung

    Sauerstoffarmes Blut kehrt vom Körperkreislauf in die Venen zurück. Sie laufen im Sinus venosus zusammen, der zum Atrium führt. Vom Atrium fließt das Blut in einen einzigen muskulösen Ventrikel. Wenn der Ventrikel kontrahiert, fließt das Blut unter Druck in den elastischen Bulbus arteriosus. Die elastische Rückstellkraft des Bulbus arteriosus hält einen ständigen Blutstrom durch die Kiemen aufrecht, wo der Austausch der Atemgase erfolgt. Das sauerstoffreiche Blut fließt aus den Kiemen in den Körperkreislauf.
  • Lungenfische, die sich in Stillgewässern fortpflanzen, können den Sauerstoffgehalt des Wassers, das ihre Eier unmittelbar umgibt, erhöhen. Wie bewerkstelligen sie das?

    Lösung

    Die Richtung der Sauerstoffdiffusionan den Kiemenlamellen hängt vom pO2-Gradienten zwischen dem Blut und dem Wasser ab, das über die Kiemen strömt. Indem der Fisch Luft in seine Lunge aufnimmt, kann er einen höheren pO2 im Blut aufrechterhalten als im umgebenden Wasser. Deshalb diffundiert O2 aus dem Blut ins Wasser und erhöht den pO2 des Wassers in der Umgebung des Geleges.
  • Erläutern Sie, weshalbbei Reptilien das Blut nicht in den Lungenkreislauf strömt, wenn sie nicht atmen, und wie dies gesteuert wird.

    Lösung

    Reptilien besitzen eine linke und eine rechte Aorta. Außer bei den Krokodilen sind die Ventrikel nicht vollständig getrennt, deshalb kann Blut aus dem rechten Ventrikel entweder in die rechte Aorta oder in die Lungenaorta fließen. Wenn das Tier in Ruhe ist oder beim Tauchen nicht atmet, ist der Strömungswiderstand im Lungenkreislauf hoch und das Blut aus beiden Ventrikeln fließt in die Aorten. Wenn das Tier atmet, vermindert sich der Widerstand im Lungenkreislauf und das Blut aus dem rechten Ventrikel strömt in den Lungenkreislauf, während Blut aus dem linken Ventrikel in die Aorten fließt. Bei Krokodilen sind die Ventrikel vollständig getrennt und die rechte Aorta verlässt den rechten Ventrikel. Aber wo die Aorten das Herz verlassen, sind sie miteinander verbunden. Wenn das Tier atmet und der Strömungswiderstand im Lungenkreislauf gering ist, schließt der Gegendruck von der linken Aorta die Klappe zwischen dem rechten Ventrikel und der rechten Aorta, sodass das gesamte Blut aus dem rechten Ventrikel in den Lungenkreislauf fließt. Wenn der Widerstand im Lungenkreislauf hoch ist, ist der Druck im rechten Ventrikel hoch genug, um die rechte Aortenklappe zu öffnen, und Blut aus dem rechten Ventrikel strömt in die rechte Aorta und in den Körperkreislauf.
  • Beim menschlichen Fetus stehen der Aortenbogen und der Verzweigungspunkt der beiden Lungenarterien über den Ductus arteriosus Botalli in offener Verbindung, um das Lungengewebe zu versorgen. Bei der Geburt wird der Ductus durch den Druck der ersten Atemzüge dauerhaft geschlossen. Was sind die Folgen, wenn der Ductus nach der Geburt offen bleibt?

    Lösung

    Wenn das Neugeborene zu atmen beginnt, sinkt der Widerstand im Lungenkreislauf. Schließt sich der Ductus arteriosus Botalli nicht, wird durch den höheren Druck im linken Ventrikel Blut durch den Ductusin den Lungenkreislauf gepumpt. Das hat zur Folge, dass zu viel Blut in den Lungenkreislauf gelangt und zu wenig sauerstoffreiches Blut in den Körperkreislauf.
  • Die Herzklappen können versteifen oder verkalken, sodass weniger Blut hindurchfließen kann. Man nennt diese Verengung Stenose. Was sinddie Folgen einer Stenose der Aortenklappe und der Pulmonalklappe?

    Lösung

    Eine Aortenklappenstenosevermindert den Blutstrom in die Aorta. Der Druck in der Aorta und in den großen Arterien sinkt und die Gewebe werden schlechter mit Blut versorgt. Müdigkeit und Kurzatmigkeit sind die Folgen. Der Druck im linken Ventrikel und seine Arbeitsbelastung steigen. Blut kann sich im Lungenkreislauf anstauen und pulmonale Hypertonie verursachen. Eine Pulmonalklappenstenosevermindert den Blutstrom zur Lunge. Deshalb wird die linke Herzkammerschlechter mit sauerstoffreichem Blut versorgt, was zu Müdigkeit und Kurzatmigkeit führt. Der Druck im rechten Ventrikel wie auch der Druck in den Venen, die zum Herzen zurückführen, steigt.
  • Digitalisglykoside sind Wirkstoffe, welchedie Ca2+-Konzentration in den Herzmuskelzellen erhöhen können. Weshalb werden sie Patienten mit einer Herzschwäche verabreicht?

    Lösung

    Die Kontraktion des Herzmuskels hängt vom Vorhandensein von Ca 2+-Ionen im Cytosol ab. Wenn sich mehrCa2+ im Cytosolbefindet, dauern die Ca 2+-Impulse nach den Aktionspotenzialen des Herzens länger. Deshalb ist der Herzschlag kräftiger, die Kontraktion dauert länger an und die Auswurfleistung ist erhöht.
  • DieStenose einer Herzklappe beeinträchtigt den Blutstrom, während bei einem Herzklappenprolaps das Blut zurückströmt (Regurgitation). Beide Defekte kann man als Herzgeräusche mit einem Stethoskop hören.Wann im Herzzyklus könnte ein Herzgeräusch auf eine Stenose der Aortenklappe hinweisen und wann auf einen Prolaps der Aortenklappe? Erläutern Sie Ihre Antwort.

    Lösung

    Eine Aortenklappenstenose führt zu einem Herzgeräusch während der Systole, wenn Druck im linken Ventrikel Blut durch die Aortenklappe befördert. Ein Prolaps der Aortenklappe sollte ein Herzgeräusch während der Diastole hervorrufen, wenn größerer Druck in der Aorta Blut durch die Aortenklappe zurück in den Ventrikel befördert.
  • Weshalb trainieren Leistungssportler oft in großer Höhenlage?

    Lösung

    Der O2-Partialdruck ist in großer Höhe über dem Meeresspiegel niedriger. Deshalb stellt sich bei den Sportlern eine Hypoxie ein. Sie akklimatisieren sich, indem sie mehr Erythrocyten bilden. Wenn die Wettkämpfe in tieferen Lagen stattfinden, verfügt ihr Blut über eine größere Sauerstofftransportkapazität.
  • Warum bezeichnet man den Prozess der Blutgerinnung als Kaskade?

    Lösung

    Die Blutgerinnung ist ein Ereignis, an dem viele Zellen und Signale beteiligt sind, obwohl es auch durch eine kleine Wunde ausgelöst werden kann, sobald Kollagenfasern freigelegt werden. Thrombocyten, die in Kontakt mit diesen Fasern kommen, werden aktiviert. Sie werden adhäsiv und heften sich auch an andere Thrombocyten, die ebenfalls aktiviert werden. Die aktivierten Thrombocyten lösen über chemische Signale viele Schritte der Gerinnungsreaktion aus. Ein kleines Ereignis führt deshalb zu immer weiteren Ereignissen, das heißt, die Blutgerinnung beruht auf einer Kaskade von Ereignissen.
  • Weshalb bezeichnet man die Arteriolen als Widerstandsgefäße und die Venen als Kapazitätsgefäße, und auf welche Funktionen weisen diese Bezeichnungen hin?

    Lösung

    Die Arteriolen bezeichnet man als Widerstandsgefäße, denn die glatte Muskulatur in ihren Wändenkann diese Gefäße verengen und so den Strömungswiderstand erhöhen. Wenn sich der Widerstand in verschiedenen Arteriolen verändert, kann das Blut in die Gewebe und Organe geleitet werden, die es am meisten benötigen. Venen bezeichnet man als Kapazitätsgefäße, denn ihre dünnen Wände mit vielen elastischen Fasern können sich stark dehnen, um ein großes Blutvolumen aufzunehmen. Wenn der Körper in Ruhe ist, ist es nicht notwendig, dass das gesamte Blut zirkuliert, um die Stoffwechselanforderungen des Körpers zu erfüllen. Ein großer Teil kann in den Kapazitätsgefäßen gespeichert werden.
  • Wenn man sehr lange Zeit hungern muss, beginnt der Körper, die Proteine im Blutplasma zur Energiegewinnung abzubauen. In diesem Stadium sammelt sich Flüssigkeit im Bauch und in den Extremitäten (Hungerödeme, Kwashiorkor). Wie hängt der Proteinabbau mit den Hungerödemen zusammen?

    Lösung

    Die Proteine im Blut sind für den osmotischen Druck verantwortlich, der die interstitielle Flüssigkeit zurück in die Kapillaren zieht. Wenn diese Proteine abgebaut werden, sinkt der osmotische Druck.Mehr Plasma, das die Kapillaren wegen des Blutdrucks verlässt, verbleibt deshalb in den interstitiellen Räumen. Die interstitielle Flüssigkeit sammelt sich im Bauch und in den Extremitäten.
  • Warum wird die Autoregulation als positive Rückkopplung beschrieben?

    Lösung

    Eine verringerte Gewebedurchblutung führt aufgrund eines Absinkens des MAD zu autoregulatorischen Antworten, die den Strömungswiderstand in dieses Gewebe vermindern. Jeder verminderte Strömungswiderstand im Körperkreislauf verursacht ein Absinken des MAD, sodass weniger O2 und Nährstoffe in das Gewebe gelangen und die autoregulatorische Antwort verstärkt wird. Mit dieser positiven Rückkopplung kann die Autoregulation das Problem verschlimmern.
  • Welche unterschiedlichen Rollen spielen die beiden Unterabteilungen des autonomen Nervensystems bei der Regulationdes MAD?

    Lösung

    Die Unterabteilung des Sympathicus des autonomen Nervensystems löst eine Vasokonstriktion in Geweben aus, die bei der Kampf-oder-Flucht-Reaktion nicht benötigt werden, wie das Verdauungssystem und die Haut. Diese Zunahme des gesamten peripheren Strömungswiderstands führt zu einem Anstieg des MAD. Die Innervierung des Herzens über sympathische Nervenfasern führt dazu, dass es schneller und kräftiger schlägt, was ebenfalls zu einem Anstieg des MAD beiträgt. Die Unterabteilung des Parasympathicus des autonomen Nervensystems hat den gegenteiligen Effekt. Sie verlangsamt den Herzschlag und senkt den MAD.
  • Dehnungsrezeptoren können mit unterschiedlicher Frequenz feuern, je nach dem Grad der Dehnung. In Ruhe feuern sie in der Mitte des Bereichs. Warum ist dies adaptiv?

    Lösung

    Die Druckrezeptoren feuern mit einer mittleren Frequenz, wenn der Blutdruck normal ist.Deshalb können sie die Feuerrate entweder erhöhen oder senken, je nachdem, ob der MAD steigt oder sinkt. Auf diese Weise tragen sie zu den regulatorischen Antworten bei.
  • Erläutern Sie, wie die lokale autoregulatorische Kontrolle des Blutstroms hormonelle Anpassungen des MAD auslösen kann.

    Lösung

    Autoregulatorische Mechanismen erweitern oder verengen die Arteriolen als Reaktion auf lokale Veränderungen des Chemismus. Diese lokalen Veränderungen im Durchmesser der Arteriolen beeinflussen die Blutmenge, die bestimmte Gewebe erreicht. Die Veränderungen wirken sich auf den Blutdruck des Körpers aus, der von Dehnungsrezeptoren wahrgenommen wird. Sie lösen neuronale und hormonelle Signale aus, die kardiovaskuläre Veränderungen im ganzen Körper verursachen können.
  • Grauwale verbringen den Sommer im Meer vor Alaska und ziehen im Winter in Meeresgebiete vor Mexiko. Während ihrer Migrationen und in den Überwinterungsgebieten nehmen sie sehr wenig oder gar keine Nahrung auf. Welche Energiequelle nutzen sie während dieser langen Zeit und welche Vorteile bietet dies?

    Lösung

    Während der Migration und in den Überwinterungsgebieten ist die Energiequelle der Grauwale gespeichertes Körperfett (Blubber). Fett hat einen hohen Energiegehalt und enthält wenig Wasser. Deshalb ist es ein idealer langfristiger Energiespeicher mit minimaler Masse. Es trägt außerdem zum Auftrieb des Walkörpers im Wasser und zur Isolierung gegen Kälte bei.
  • Das Volk der Inuit verzehrt die Leber von Eisbären nicht, denn sie enthält so viel Vitamin A, dass eine ernsthafte Erkrankung, die Hypervitaminose A, die Folge wäre. (Da Eisbärenleber voller Trichinen ist, würden sie zudem an einer schweren Trichinose erkranken.) Warum gibt es keine Hypervitaminose C?

    Lösung

    Vitamin A ist fettlöslich und kann sich im Körper ansammeln. Vitamin C ist wasserlöslich und wird bald mit dem Urin ausgeschieden, sodass sich keine toxischen Mengen ansammeln können.
  • Bei einer Anämie fehlt das Mikronährelement Eisen. Frauen vor den Wechseljahren leiden häufiger an Anämie als Männer. Weshalb?

    Lösung

    Das Mikronährelement Eisen wird größtenteils im Körper wiederverwertet, aber mit dem Blutverlust bei der Menstruation verlieren Frauen vor den Wechseljahren einmal im Monat Eisen.
  • Ein Komapatient wird über eine Magensonde mit einer Nährstoffmischung ernährt. Einem Patienten, dessen Magen-Darm-System nicht funktionsfähig ist, wird die Nährstoffmischung über die Blutgefäße verabreicht. Die Mischung, die in den Magen geleitet wird, enthält Proteine, derüber die Blutgefäße verabreichten Mischung fehlen Proteine dagegen. Warum ist das so? Was ist statt der Proteine in der Mischung enthalten?

    Lösung

    Wenn körperfremde Proteine in der Mischung enthalten wären, die über die Blutgefäße verabreicht wird, würden sie eine Immunantwort des Patienten auslösen. Deshalb müssen in der Mischung alle essenziellen Aminosäuren enthalten sein.
  • Warum verbringen Herbivoren typischerweise mehr Zeit mit der Nahrungsaufnahme als Carnivoren?

    Lösung

    Herbivoren müssen viel Zeit mit dem Fressen verbringen, weil ihre pflanzliche Nahrung wenig Energie enthält und sowohl mechanisch (durch das Kauen) wie auch chemisch (durch die Verdauung) sehr stark aufbereitet werden muss.
  • Was haben alle Verdauungsenzyme hinsichtlich ihrer Wirkung gemeinsam?

    Lösung

    Alle Verdauungsenzyme spalten die Substrate hydrolytisch.
  • Warum haben viele Menschen nach einer Behandlung mit Antibiotika Probleme mit der Verdauung?

    Lösung

    Eine Behandlung mit Antibiotika dezimiert die Darmflora oft stark. Deshalb kann es zu einer veränderten Verdauung kommen.
  • Wenn Menschen, die unter Zöliakie leiden, glutenhaltige Nahrungsmittel konsumieren, schädigt ihr Immunsystem die Dünndarmzotten. Wird die Krankheit nicht diagnostiziert, leiden die Betroffenen häufig unter Blähungen, Bauchschmerzen, Durchfall, Fettstuhl und Eisenmangel und verlieren an Körpergewicht. Weshalb treten diese Symptome auf?

    Lösung

    Die Ursache der Symptome ist die Schädigung der Darmzotten. Diese nehmen die Verdauungsprodukte dann weniger effektiv auf, sodass es zu Unterernährung und einem Mangel an Mikronährelementen wie Eisen kommen kann. Nicht resorbierte Verdauungssubstrate ziehen Wasser in den Darm, sodass Durchfall die Folge ist. Zudem fördern sie den Stoffwechsel der Mikroben, was zu Blähungen führt. Wenn die Darmzotten geschädigt sind, ist die Oberfläche, die für die Verdauung zur Verfügung steht, geringer. Dies wirkt sich auf die Freisetzung von Nährstoffmonomeren und deren Resorption aus. Unverdaute Fette führen zu Fettstuhl.
  • Erläutern Sie, warum in der Schwerelosigkeit im Weltraum die Nahrung dennoch vom Mund in den Magen gelangt.

    Lösung

    Die Zunge schiebt die gekaute Nahrung im Mund nach hinten und löst den Schluckreflex aus, der die Nahrung durch die Aktivierung vieler Muskeln in den Ösophagus schiebt. Wenn die glatte Muskulatur im Ösophagus gedehnt wird, wird sie zur Kontraktion angeregt, sodass die Nahrung in Richtung Magen geschoben wird. Die Richtung dieser Bewegung wird vom enterischen Nervensystem unterstützt, das die Muskeln vor dem Nahrungsbolus veranlasst, sich zu entspannen. Wenn der Bolus den Ösophagussphinkter erreicht, öffnet er sich, sodass die Nahrung in den Magen gelangen kann. Die Koordination der Kontraktion und Entspannung der glatten Muskulatur erzeugt peristaltische Wellen, die die Nahrung im Ösophagus auf den Magen zu bewegen, auch in der Schwerelosigkeit.
  • Biochemiker zerkleinerten ein Stück Magenwand und stimulierten es mit dem Hormon, das den Magen veranlasst, HCl zu sezernieren. Der pH-Wert der Lösung veränderte sich nicht. Weshalb nicht?

    Lösung

    Magensäure wird im Magen von Zellen in den Magengrübchen gebildet. In diesen sogenannten Belegzellen katalysiert die Carboanhydrase die Hydratisierung von CO2, sodass H2CO3 entsteht, das in HCO3- und H+ dissoziiert. Das H+ wird im Austausch gegen K+ in das Lumen des Magengrübchens transportiert. HCO3- wird an der Blutseite der Zelle im Austausch gegen Cl--Ionenin die interstitielle Flüssigkeit und weiter ins Blut transportiert. Das überschüssige K+ diffundiert aus der Zelle und wird über den Austausch von H+ gegen K+ zurücktransportiert. Deshalb hängen die Konzentration von H+ im Magenlumen und die Abscheidung von HCO3- in die interstitielle Flüssigkeit von einer intakten Magenwand ab. Wird diese zerstört, bleibt die Trennung von H+ und HCO3- aus. Der pH-Wert verändert sich dann nicht.
  • Wie unterstützt die Galle die Verdauung von Fetten und weshalb sind keine Moleküle mit gleicher Funktion nötig, um den Transport von Fetten in der Lymphe und im Blut zu erleichtern?

    Lösung

    Gallenflüssigkeit emulgiert Fette in der Nahrung. Es entstehen winzige Micellen, die den wasserlöslichen Lipasen eine große Oberfläche bieten. Die Galle verhindert, dass sich die Micellen zu größeren Fetttröpfchen mit einer kleineren Oberfläche verbinden. Gleichwertige Moleküle werden in der Lymphe und im Blut nicht benötigt, denn die Fette in Lymphe und Blut werden mit Phospholipiden und Proteinen kombiniert als Lipoproteine transportiert.
  • Erläutern Sie, weshalb die Mikroorganismen im Verdauungstrakt eine wichtige Nährstoffquelle für Wiederkäuer sind, nicht aber für Menschen.

    Lösung

    Die Mikroorganismen im Magen sind für Wiederkäuer eine wichtige Nährstoffquelle, denn sie wachsen im Pansen und Netzmagen mit aufgenommener Nahrung, bevor die vorverdaute Nahrung der Salzsäure und den Verdauungsenzymen des Magens und Dünndarms ausgesetzt wird. Bei Menschen befinden sich viele Mikroorganismen im hinteren Dünndarm und im Dickdarm. Sie können deshalb nicht in der vorderen Region des Dünndarmsals Nährstoffquelle verdaut werden.
  • Erklären Sie, weshalb im Verdauungssystem der Wiederkäuer HCl im Labmagen (Abomasum) sezerniert wird, aber nicht im Pansen, Netzmagen oder Blättermagen.

    Lösung

    Ein Wiederkäuer bildet keine Enzyme, die nötig wären, um die Cellulose der aufgenommenen Pflanzennahrung zu hydrolysieren. Im Pansen und Netzmagen befinden sich Gemeinschaften von Mikroorganismen, die Cellulasen bilden und die Pflanzennahrung zersetzen. Die daraus resultierende, vergorene Mischung aus Pflanzenbrei und Mikroorganismen bewegt sich in den Blättermagen, wo Wasser entzogen wird. Aus dem Blättermagen bewegt sich die nährstoffreiche Masse in den Labmagen. Hier wird Salzsäure sezerniert, die die Verdauung unterstützt und Mikroorganismen abtötet. Diese bilden einen wichtigen Bestandteil der Nahrung.
  • Weshalb begünstigen die autokatalytischen Eigenschaften von Pepsin einen positiven Rückkopplungsmechanismus der Proteinhydrolyse im Magen?

    Lösung

    Wenn nur ein kleiner Anteil Pepsinogen durch hydrolytische Spaltung das aktive Enzym Pepsin bildet, wirkt dieses auf weitere Pepsinogenmoleküle ein, sodass in einer autokatalytischen Kaskade immer mehr Pepsin freigesetzt wird. Dies ist ein Beispiel für eine positive Rückkopplung, bei der ein Produkt einer Reaktion (Pepsin) weitere Reaktionen stimuliert (Pepsinogen → Pepsin), sodass die Menge an Reaktionsprodukt (Pepsin) immer größer wird.
  • Aus verschiedenen Gründen werden Patienten über eine Magensonde oder eine Sonde ernährt, die bis in das Jejunum führt, den mittleren Teil des Dünndarms. Wie sollten sich die Nährstoffzusammensetzung für die Dünndarmsonde und die Magensonde unterscheiden?

    Lösung

    Eine Nährstoffmischung, die in das Jejunum verabreicht wird, stimuliert die Freisetzung von Sekretin und Cholecystokinin nicht. Deshalb wird keine Galle sezerniert, um komplexe Lipide zu emulgieren. Außerdem sind keine Enzyme des Pankreas vorhanden, um komplexe Kohlenhydrate und Proteine zu verdauen. Deshalb muss die Zusammensetzung für das Jejunum aus mittel- bis kurzkettigen Fettsäuren und teilweise hydrolysierten Kohlenhydraten und Proteinen bestehen.
  • Wie unterschieden sich die drei Klassen der Lipoproteine in Struktur und Funktion?

    Lösung

    Die drei Klassen der Lipoproteine unterscheiden sich in den prozentualen Anteilen von Proteinen, Lipiden (Triacylglycerine und Phospholipide) und Cholesterol. HDL haben den geringsten prozentualen Anteil an Triacylglycerinen und transportieren Cholesterol aus den Geweben in die Leber, wo es zur Herstellung von Galle verwendet wird. LDL enthalten weniger Proteine und Lipide und mehr Cholesterol. Cholesterol kann an den Innenwänden von Arterien abgelagert werden kann.VLDL bestehen vor allem aus Triacylglycerinen, die sie an Fettzellen abgeben, sodass LDL daraus hervorgehen.
  • Wie wirkt sich ein hoher bzw. niedriger Insulinspiegel auf die Leber und die Muskulatur aus? Was ist gleich und was verschieden?

    Lösung

    Sowohl in der Muskulatur wie auch in der Leber fördert Insulin die Aufnahme von Glucose und die Glykogensynthese. Wenn der Insulinspiegel sinkt, sind die Auswirkungen in Leber und Muskulaturunterschiedlich. In der Leber wird die Glucose-6-Phosphatase aktiviert. Glucose, die durch das Zerlegen von Glykogen gebildet wird, kann in die interstitielle Flüssigkeit entlassen werden. In der Muskulatur findet dieser Prozess nicht statt, und deshalb ist die Glucose in der Muskulatur „gefangen“.
  • Betrachten Sie die Experimente, in denen der laterale oder der ventromediale Hypothalamus von Ratten geschädigt wurde. Welches Ergebnis lässt darauf schließen, dass sich die Regulationdes Körpergewichts veränderte und nicht nur das Empfinden von Sättigung oder Hunger, das der Ernährungszustand hervorruft?

    Lösung

    In den Experimenten, in denen der laterale oder der ventromediale Hypothalamus von Ratten geschädigt und die darauf folgenden Veränderungen im Körpergewicht ermittelt wurden, nahmen die Tiere entweder zu oder ab, aber schließlich stellte sich ein neues Gleichgewicht ein. Dies weist darauf hin, dass die Regulation aufrechterhalten, aber der Sollwert verstellt wurde.
  • Wenn Muskeln nicht mit ausreichend Sauerstoff versorgt werden, bilden sie durch Glykolyse kleine Mengen ATP, aber sie bilden auch Pyruvat und Lactat. Erläutern Sie, wie Pyruvat und Lactat dazu beitragen, dass die Glykolyse weiter ablaufen kann.

    Lösung

    Pyruvat und Lactat, die bei Muskelarbeit im anaeroben Bereich gebildet werden, gelangen in den Kreislauf und werden von der Leber aufgenommen, wo sie durch Gluconeogenese in Glucose umgewandelt werden. Diese Glucose kann dann wieder ins Blut freigesetzt werden, sodass die Glykolyse weiter ablaufen kann.
  • Welche Beobachtung stützt die Hypothese, dass Leptin das Sättigungsgefühl beeinflusst?

    Lösung

    Mäuse, die aufgrund einer Mutation kein Leptin bilden, fressen mehr und werden fettleibig. Wenn die Mäuse chirurgisch mit normalen Mäusen, die Leptin bilden, zu parabiotischen Paaren verbunden werden, fressen die fettleibigen Mäuse weniger und verlieren an Gewicht.
  • Welche Bedeutung hat das geschlossene Kreislaufsystem der Wirbeltiere für die Osmoregulation im Süßwasser?

    Lösung

    Ein Wirbeltier im Süßwasser muss ein Osmoregulierer sein, um Salze zurückzuhalten und Wasser auszuscheiden. Mit seinem geschlossenen Kreislaufsystem kann es den Blutdruck einsetzen, um die extrazelluläre Flüssigkeit zu ultrafiltrieren. So kann Wasser ausgeschieden werden, während Salze und andere Solute nicht verloren gehen.
  • Weshalb ist Osmoregulation für A. salina als Bewohner der Gezeitenzone wichtig, und wie bewältigt A. salina die Osmoregulation, wenn seine Umgebung extrem salzhaltig ist?

    Lösung

    Bei Ebbe kann es passieren, dass ein Tier der Gezeitenzone in einem isolierten Gezeitentümpel zurückbleibt. Bei Regen wird das Meerwasser dort stark verdünnt und bei Hitze durch Verdunstung sehr salzhaltig. A. salina kann als sehr guter Osmoregulierer über einen weiten Bereich des Salzgehalts überleben, aber es kann nicht in Süßwasser oder einer gesättigten Salzlösung überleben. In verdünntem Meerwasser transportiert A. salina NaCl als Ionen über seine Kiemenmembranen, um hyperosmotisch zu regulieren. In sehr salzhaltigem Wasser reguliert es hypoosmotisch.
  • Wie gelangt bei Seevögeln Wasser in die Zentralkanäle der im Kopf gelegenen Salzdrüsen?

    Lösung

    Bündel von Sekretionstubuli entleeren sich in die Zentralkanäle der Salzdrüsen. Die Zellen dieser Tubuli transportieren aktiv Cl--Ionen in das Lumen, Na+ folgt passiv nach. Wasser wird durch Osmose in den Tubulus gezogen und spült den Inhalt in den Zentralkanal.
  • Wenn Aminosäuren abgebautwerden, ist ein erster Schritt die Abspaltung der Aminogruppe, sodass Ammoniak entsteht. Was geschieht mit dem Ammoniak bei einem Fisch und bei einem Säugetier? Erläutern Sie, weshalb dies geschieht.

    Lösung

    Ammoniak ist hochgiftig und muss entweder rasch ausgeschieden oder entgiftet werden. Ammoniak ist in Wasser gut löslich und diffundiert schnell, deshalb kann es bei Fischen ins Blut diffundieren und dann durch Diffusion über die Kiemenmembranen in das umgebende Wasser abgegeben werden. Weil die Ventilation der Säugetiere bidirektional ist, müsste die Ammoniakkonzentration in ihrem Blut höher sein, um durch Diffusion über die Alveolarmembranen abgegeben zu werden. Dann wäre es aber zu giftig. Deshalb entgiften Säugetiere Ammoniak, indem sie ihn in Harnstoff oder Harnsäure umwandeln.
  • Warum bilden Haie und Rochen Harnstoff statt Harnsäure, um die osmotische Konzentration in ihrer extrazellulären Flüssigkeit zu erhöhen?

    Lösung

    Harnsäure ist weniger gut wasserlöslich als Harnstoff. Bei Menschen mit ihrer Osmolarität der extrazellulären Flüssigkeitenvon 300 mosm/l würde sie sehr leicht ausfallen. Deshalb ist Gehalt an Harnsäure dort sehr niedrig. Haie und Rochen könnten mit Harnsäure keine extrazelluläre Osmolarität erzeugen, die höher ist als die des Meerwassers.
  • Welchen Vorteil hat es für ein terrestrisches Tier, Harnsäure als stickstoffhaltiges Abfallprodukt abzugeben?

    Lösung

    Die meisten terrestrischen Tiere müssen Wasser sparen. Der Vorteil der Ausscheidung von Harnsäure ist, dass sie im Exkretionssystem ausfallen kann. Deshalb wird die Reabsorption von sehr viel Wasser möglich.
  • Wie können Plattwürmer mit ihren Protonephridien in Süßgewässern leben?

    Lösung

    Im Süßwasser lebende Plattwürmer müssen damit zurechtkommen, dass durch Osmose ständig Wasser in ihre extrazelluläre Flüssigkeit strömt. Mit den Wimpernflammen kann die extrazelluläre Flüssigkeit in die Protonephridien druckfiltriert werden, ohne dass Proteine oder Zellen verloren gehen. Die Protonephridien können das Ultrafiltrat durch Sekretion und Reabsorption weiterverarbeiten, sodass mehr Abfallstoffe ausgeschieden und wichtige Solute zurückgewonnen werden.
  • Wie stehen bei Anneliden Blutplasma, Coelomflüssigkeit und Harn miteinander in Verbindung?

    Lösung

    Das Blutplasma wird durch Kapillarwände in die Coelomflüssigkeit ultrafiltriert. Beide Flüssigkeiten ähneln sich in ihrer Zusammensetzung. Die Coelomflüssigkeit wird in den Metanephridien durch Sekretion und Reabsorption verarbeitet, und der entstehende Harn wird ausgeschieden.
  • Auf welche Weise spart das Exkretionssystem eines Insekts Wasser ein?

    Lösung

    Das Exkretionssystem der Insekten scheidet stickstoffhaltige Abfallprodukte als Harnsäure aus. Indem im Enddarm und Rectum aktiv Na+ und K+ in die Hämolymphe reabsorbiert werden, wird die Abfallflüssigkeit so stark konzentriert, dass Harnsäure ausfällt und damit die Osmolarität des Inhalts von Enddarm und Rectum sinkt. Durch die aktive Reabsorption von Na+ und K+ kann also mehr Wasser reabsorbiert werden.
  • Wie hängt die Notwendigkeit des Wassersparens mit der Evolution der inneren Befruchtung zusammen?

    Lösung

    Als Wirbeltiere trockenere terrestrische Lebensräume besiedelten, mussten sie ihren Wasserverlust deutlich senken. Zudem sind Gewässer, die für eine äußere Befruchtung notwendig sind, in solchen Lebensräumen oft nicht vorhanden.Sowohl Amphibien als auch Reptilien haben verschiedene Anpassungen entwickelt, um die Verdunstung über ihre Haut zu vermindern. Die Reptilien sind jedochbei der Fortpflanzung nicht mehr von Gewässern abhängig, denn sie legenamniotische Eier. Diese Eier müssen jedoch im Körperinneren der Weibchen befruchtet werden, bevor sie von einer schützenden Schale umgeben werden. Deshalb muss sich die innere Befruchtung parallel zum Ei der Amnioten entwickelt haben.
  • Welche Rolle spielen die afferenten und efferenten Arteriolen im Nephron?

    Lösung

    Die afferenten Arteriolen transportieren Blut unter hohem Druck in den Glomerulus, um die Ultrafiltration zu bewirken. Die efferenten Arteriolen transportieren das Blut vom Glomerulus zu den peritubulären Kapillaren. Hier finden die Sekretion und Reabsorption von Soluten statt.
  • Was sind die anatomischen Komponenten des glomerulären Ultrafilters?

    Lösung

    Die anatomischen Komponenten des glomerulären Filters sind die Fenestrierung der Kapillarendothelzellen, die Basalmembran der Kapillarendothelzellenund die Filtrationsschlitze zwischen den Podocytenfortsätzen der Bowman-Kapsel.
  • Wie kommt es dazu, dass sich die Zusammensetzung des Urinsvon der Zusammensetzung des Blutes unterscheidet?

    Lösung

    Die Zusammensetzung des Harns wird durch Prozesse der selektiven aktiven Reabsorption und Sekretion in den Nierentubuli verändert und unterscheidet sich deshalb von der des Blutplasmas.
  • Wenn Sie die Anzahlder Mitochondrien im Gewebe der Säugerniere bestimmen könnten, wo würden Sie die höchste, die niedrigste und eine mittlere Anzahlfinden? Erläutern Sie Ihre Antwort.

    Lösung

    Die höchste Zahl an Mitochondrien würden Sie in der Rindenschicht finden, denn alle aktiven Transportmechanismen finden in den distalen Tubuli statt. Am geringsten ist die Zahl im unteren Bereich des Marks, wo sich nur dünne Segmente der Henle-Schleifen befinden. Eine mittlere Anzahl findet sich im oberen Bereich des Marks, denn hier befinden sich aktive Transporter für Na+ in den dicken Segmenten der aufsteigenden Äste der Henle-Schleifen.
  • Wie funktioniert das Gegenstrommultiplikationssystem der Henle-Schleifen?

    Lösung

    Das dicke Segment des aufsteigenden Astes der Henle-Schleife transportiert aktiv Na+ aus dem Harn in die extrazelluläre Flüssigkeit, und Cl- folgt nach. Durch die Zunahme der NaCl-Konzentration in der extrazellulären Flüssigkeit des Marks wird Wasser osmotisch aus dem absteigenden Ast gezogen, sodass dort die Konzentration de Harns steigt. Da der absteigende Ast nicht wasserdurchlässig ist, wird dort durch den konzentrierteren Harn kein Wasser in die Henle-Schleife gezogen. Wenn der Harn das dicke Segment des aufsteigenden Astes erreicht, wird mehr Na+ in die extrazelluläre Flüssigkeit gepumpt (Cl- folgt wieder passiv nach). Durch diesen Mechanismus wird die Osmolarität der interstitiellen Flüssigkeit in der Markschicht höher gehalten als die Blutosmolarität.
  • Wie werden sichbeim Vergleich einer WasserrattenartmiteinerWüstenrattenart gleicher Körpergröße die Nieren in der anatomischen Struktur Ihrer Meinung nach unterscheiden? Erläutern Sie Ihre Antwort.

    Lösung

    Die Wüstenrattenart hat längere Henle-Schleifen und deshalb eine dickere Markschicht als die Wasserrattenart. Wüstenratten haben sich unter dem Evolutionsdruck entwickelt, Wasser einsparen zu müssen. Eine Möglichkeit ist, einen konzentrierteren Harn zu bilden. Je länger die Henle-Schleifen, desto größer steiler ist der osmotische Gradient, der in der Markschicht erzeugt wird. Deshalb sollten Wüstenrattenarten längere Henle-Schleifen haben als Wasserrattenarten.
  • Die Zellen der Nierentubuli sezernieren aktiv Protonen. Wie führt dies dazu, dass die Hydrogencarbonatkonzentrationim Blut steigt?

    Lösung

    Hydrogencarbonat wird aus dem Blut in den Harn filtriert, aber die H+-Ionen, die von den Tubuluszellen in den Harn gepumpt werden, verbinden sich mit diesem Hydrogencarbonat zu H2CO3 (Kohlensäure), das zu H2O und CO2 dissoziiert. Das CO2 diffundiert in die Tubuluszellen, wo durch die Carboanhydrase die Hydratisierung zu H2CO3 katalysiert wird. Das daraus entstehende HCO3- wird durch die Plasmamembran der Tubuluszellen in die Basalmembran transportiert und diffundiert von dort in die interstitielle Flüssigkeit.
  • Aufgrund welcher Mechanismen regulieren die afferenten und efferenten glomerulären Arteriolen die glomeruläre Filtrationsrate,und wie werden diese Antworten kontrolliert?

    Lösung

    Die afferenten und efferenten glomerulären Arteriolen regulieren die glomeruläre Filtrationsrate (GFR), indem sie ihren Strömungswiderstand verändern. Wenn der Blutdruck steigt, verengen sich die afferenten Arteriolen, sodass sich der Widerstand erhöht. Sinkt der Blutdruck, verengen sich die efferenten Arteriolen. Wenn sich die afferenten Arteriolen verengen, nimmt die GFR ab, und wenn sich die efferenten Arteriolen verengen, erhöht sich die GFR. Die afferenten Arteriolen verengen sich aufgrund der allgemeinen Eigenschaften glatter Muskulatur: Wird die Muskulatur gedehnt, kontrahiert sie sich.
    Wenn der Blutdruck sinkt und somit die GFR abnimmt, ist die Feedback-Information ein Absinken der Solutkonzentration im distalen Tubulus. Als Reaktion darauf signalisieren die Macula-densa-Zellen der Muskulatur der afferenten Arteriolen, sich zu entspannen. Die Macula-densa-Zellen lösen außerdem eine Verengung der efferenten Arteriolen aus, indem sie Renin freisetzen. Dies führt zur Umwandlung von Angiotensinogen in Angiotensin, welches wiederum die efferenten Arteriolen stimuliert, sich zu verengen.
  • Aldosteron stimuliert die Aktivität der Natrium-Kalium-Pumpenim distalen Tubulus und in den Anfangsbereichen der Sammelrohre. Die Aldosteronfreisetzung wird durch Angiotensin ausgelöst. Erläutern Sie auf Basis dieser Information die Bedeutung der Tatsache, dass die Natrium-Kalium-Pumpen der Tubuluszellen jeweils für drei Na+-Ionen, die in das Interstitium reabsorbiert werden, zwei K+-Ionen in den Harn sezernieren.

    Lösung

    Die Freisetzung von Renin und die daraus resultierende Bildung von aktivem Angiotensin werden ausgelöst, wenn der Blutdruck fällt und deshalb auch die GFR absinkt. Ein Mechanismus des Renin-Angiotensin-Aldosteron-Systems ist, die Wasserreabsorption der Nieren zu erhöhen, sodass das Blutvolumen aufrechterhalten wird. Um Wasser zu reabsorbieren, ist es notwendig, die Reabsorption von Na+ zu erhöhen. So wird ein osmotischer Gradient erzeugt, der Wasser aus dem Harn in die Tubuluszellen zieht. Wenn die Natrium-Kalium-Pumpen Na+-Ionen gegen gleich viele K+-Ionen austauschen würde, entstünde kein osmotischer Gradient.
  • Stellen Sie sich vor, Sie würden viel salzhaltige Hühnerbrühe mit einer Osmolarität von 300 mosm/l trinken. Welche beiden Mechanismen spielen eine Rolle, wenn Ihre Nieren das überschüssige Flüssigkeitsvolumen und das überschüssige Na+ ausscheiden? Erläutern Sie Ihre Antwort.

    Lösung

    Die Hühnerbrühe hat dieselbe Osmolarität wie die Körperflüssigkeiten, deshalb erhöht die Absorption aus dem Darm die Osmolarität des Blutes nicht, aber das Blutvolumen und der Blutdruck steigen an. Die Erhöhung des Blutdrucks stimuliert die Dehnungsrezeptoren in den Wänden der Halsschlagadern (Carotis-Arterien), sodass die ADH-Freisetzung gehemmt wird. Dies hat zur Folge, dass die Nieren weniger Wasser reabsorbieren und deshalb mehr Harn bilden. Zusätzlich stimuliert eine Zunahme des Blutvolumens die Freisetzung vonatrialem natriuretischem Peptid (ANP), das die Natriumreabsorption senkt. Deshalb wird mehr Wasser ausgeschieden, sodass das Blutvolumen und der Blutdruck sinken.
  • Wie unterscheidet sich ein fixiertes Handlungsmuster von einer Verhaltensweise, die ein Tier nach operanter Konditionierung nach Pawlow zeigt?

    Lösung

    Fixierte Handlungsmuster sind genetisch determinierte, adaptive Verhaltensweisen, die gewöhnlich durch spezifische natürliche Reize aktiviert werden. Konditionierte Reflexe nach Pawlow sind physiologische Vorgänge, die durch erlernte, unnatürliche Reize ausgelöst werden. Verhaltensweisen, die auf operante Konditionierung zurückgehen, sind zufällige Verhaltensweisen ohne physiologische oder adaptive Signifikanz. Sie werden durch unnatürliche Reize ausgelöst, die das Tier erlernt hat und die in Verbindung mit einer Belohnung stehen, wenn das Verhalten gezeigt wird.
  • Was können die Ursachen dafür sein, dass ein genetisch determiniertes Verhalten in einem Deprivationsexperiment nicht gezeigt wird?

    Lösung

    Ein genetisch determiniertes Verhalten wird im Deprivationsexperiment nicht gezeigt, wenn sich das Tier nicht in der richtigen Entwicklungsphase oder der richtigen physiologischen Verfassung befindet und wenn die notwendigen Reize als Auslöser für das Verhalten fehlen.
  • Nennen Sie proximate und ultimate Ursachen von Balzverhalten.

    Lösung

    Proximate Ursachen für Balzverhalten sind, dass sich das Tier physiologisch in einer fruchtbaren Phase befindet und ein ebenfalls fruchtbarer Artgenosse entsprechende Reize aussendet. Die ultimate Ursache des Balzverhaltens ist der Reproduktionserfolg, das heißt, dass möglichst viele Nachkommen überleben und sich als adulte Tiere ebenfalls fortpflanzen.
  • In jüngerer Zeit wurde eine Methode entwickelt, die Expression der Gene, die Oxytocin oder das antidiuretische Hormon codieren, bei Rocky-Mountains-Wühlmäusen zu verstärken. Zu welchen Verhaltensunterschieden könnte eine solche Behandlung führen? Was könnten die Gründe dafür sein, dass das erwartete Ergebnis nicht zu beobachten ist?

    Lösung

    Bei einer verstärkten Expression der Gene, die bei Rocky-Mountains-Wühlmäusen Oxytocin und das antidiuretische Hormon codieren, ist zu erwarten, dass die Wühlmäuse häufiger Paare bilden. Sowohl Männchen als auch Weibchen sollten sich verstärkt um ihre Jungen kümmern. Wenn das Ergebnis nicht beobachtet werden kann, könnte die Ursache der Mangel an Rezeptoren in den zuständigen Gehirnregionen der Wühlmäuse sein.
  • Stellen Sie sich vor, Sie würden zwei Individuen aus verschiedenen Populationen kreuzen, die reinerbig (homozygot) für ein Verhaltensmerkmal sind, das sich bei den beiden Populationen unterscheidet. Was können Sie über die genetische Grundlage dieses Verhaltens schlussfolgern, wenn sich alle Nachkommen wie eines der Elterntiere verhalten?

    Lösung

    Man könnte daraus schließen, dass das Verhalten von einem einzigen Gen mit einem dominanten und einem rezessiven Allel kontrolliert wird.
  • Was sind die evolutionären Vorteile eines artspezifischen Balz- und Paarungsverhaltens, das wie bei Drosophila von einer Genkaskade kontrolliert wird?

    Lösung

    Die evolutionären Vorteile eines artspezifischen Balz- und Paarungsverhaltens, das von einer Genkaskade kontrolliert wird, sind: (1) Ein einziges Signal kann eine komplizierte Kombination von Antworten auslösen, die für das Verhalten notwendig sind. (2) Die zeitliche Koordination all dieser Antworten ist sichergestellt.
  • Warum gilt eine weibliche Ausprägung des Sexualverhaltens bei Ratten als Standard?

    Lösung

    Wenn neugeborene, genetisch männliche oder weibliche Ratten sterilisiert werden, entwickeln beide als adulte Tiere weibliche sexuelle Reaktionen auf Östrogengaben, und beide reagieren nicht auf Testosterongaben.
  • Erläutern Sie, warum ein Singvogel, der als adulter Vogel taub gemacht wurde, seinen Gesang singen kann, nicht jedoch ein Vogel, der vor der Geschlechtsreife taub gemacht wurde.

    Lösung

    Der Vogel singt den Gesang erst, wenn er geschlechtsreif ist, und er erlernt ihn nach einem Muster, das sich während seiner Zeit als Nestling entwickelt hat. Um zu lernen, muss er üben und sich dabei selbst singen hören. Wenn sich der Gesang manifestiert hat, kann der Vogel ihn auch dann noch singen, wenn er taub gemacht wurde.
  • Unter welchen Bedingungen kann die Variabilität eines artspezifischen Verhaltenseinen adaptiven Vorteil haben und unter welchen Bedingungen nicht?

    Lösung

    Wenn ein artspezifisches Verhalten wie der Vogelgesang eine gewisse Variabilität aufweist, kann dies adaptiv sein, wenn ein Individuum damit seine Zugehörigkeit zu einer lokalen Population demonstrieren kann oder eine neu entwickelte Strophe seine Attraktivität für mögliche Partnerinnen steigert. Variabilität ist beim Vogelgesang nicht adaptiv, wenn sie dazu führt, dass der Sänger nicht erkannt wird. Kehrt ein Individuum beispielsweise in sein Revier zurück, um sich mit einer früheren Partnerin zu paaren oder seinen Nachwuchs zu füttern, ist es wichtig, dass man es erkennt.
  • Bei Rotschulterstärlingen bauen die Männchendie Nester bevorzugt in Sümpfen, bei der Nahrungssuche jedoch bevorzugen sie Wiesen im Hochland. Welche Kosten und Nutzen waren bei der Ausbildung dieser Verhaltensweisen Ihrer Meinung nach entscheidend?

    Lösung

    Der Nutzen eines Nistplatzes im Sumpf ist ein besserer Schutz vor Fressfeinden. Kosten sind hier eine stärkere Konkurrenz um die Nistplätze und weniger vorhandene Nahrung. Im Hochland finden die Stärlinge mehr Nahrung und müssen deshalb keine Nahrungsreviere verteidigen. Hier sind sie jedoch nicht so gut vor Fressfeinden geschützt, und sie müssen das Nest während der Nahrungssuche unbewacht lassen.
  • Bei Buntbarschen kommen dominante Männchen mit bunten Mustern vor, die Reviere verteidigen. Es gibt auch nicht dominante Männchen, die unauffällig gefärbt sind und keine Reviere verteidigen.Sie tauchen gelegentlich auf, wenn ein Weibchen ablaicht, und befruchten einige ihrer Eier. Was sind die Kosten und Nutzen dieser beiden Verhaltensweisen?

    Lösung

    Die Kosten des dominanten Verhaltens der Männchen sind die Energiekosten, die mit der Verteidigung des Reviers und der Balz verbunden sind. Außerdem entstehen Opportunitätskosten, weil den Männchen weniger Zeit zur Nahrungsaufnahme bleibt. Der Nutzen ist die hohe Wahrscheinlichkeit, eine Partnerin anzulocken und ihre Eier zu befruchten. Bei den nicht dominanten Männchen entfallen die Kosten der Revierverteidigung und der Balz. Der Nutzen ist, dass sie sich dennoch fortpflanzen können.
  • See-Elefanten verteidigen ein Stück Strand als Revier und Präriehühnerein Stück Grasland. See-Elefantenbullen sind viel größer als die Weibchen und kämpfen heftig um die Reviere. Männliche Präriehühner sind dagegen kaum größer als die Weibchen. Sie balzen auffällig, kämpfen aber nicht heftig mit benachbarten Männchen. Welche Selektionsdrücke haben die unterschiedlichen Verhaltensweisen dieser beiden Tierarten Ihrer Meinung nach geformt?

    Lösung

    Weibliche See-Elefanten brauchen einen Zugang zu einem Strandabschnitt, um ihre Jungen gebären und großziehen zu können. Bullen können diesen Zugang garantieren, indem sie Geschlechtsgenossen von ihrem Strandabschnitt vertreiben. Deshalb ist es für Bullen entscheidend, Geschlechtsgenossen körperlich überlegen zu sein, und die natürliche Selektion hat sie dafür immer mehr verbessert. Weibliche See-Elefanten können sich ihren „Strandwart“ nicht aussuchen. Weibliche Präriehühner dagegen benötigen für die Aufzucht ihrer Jungen kein Revier, das ein Männchen verteidigt. Deshalb können sie einfach das Männchen auswählen, das ihnen am attraktivsten erscheint. In diesem Fall hat die natürliche Selektion ein Balzverhalten der Männchen herausgebildet, das an Weibchen und nicht an andere Männchen gerichtet ist.
  • Stellen Sie sich ein Tier vor, das die Wahl zwischen zwei Nahrungsquellen hat. Eine ist kalorienreich, aber weiträumig in offenem Gelände verteilt. Die andere ist kalorienarm, aber in großer Dichte in einer geschützten Umgebung vorhanden. Welche Selektionsdrücke wirken auf die Nahrungspräferenz dieser Tierart?

    Lösung

    Zum einen minimiert der Selektionsdruck die Opportunitätskosten. Deshalb ist die Kalorienmenge, die bei einer Mahlzeit aufgenommen werden kann, eine entscheidende Variable. Die Gefahr, bei der Nahrungsaufnahme einem Fressfeind zum Opfer zu fallen, stellt ebenfalls einen Selektionsdruck dar. Das unterschiedlich hohe Risiko, im offenen Gelände oder in einer geschützten Umgebung erbeutet zu werden, ist eine entscheidende Variable.
  • Was ist ein freilaufender, circadianer Rhythmus, und wie wird er durch Licht an einen 24-Stunden-Tag angepasst?

    Lösung

    Ein freilaufender, circadianer Rhythmus wird nicht durch ein regelmäßiges Signal wie den Sonnenauf- und -untergang an die Umwelt angepasst, sondern er läuft nach einem endogenen Turnus ab. Wenn ein zeitgebender Reiz wie ein regelmäßiger Hell-Dunkel-Zyklus auf einen freilaufenden Rhythmus einwirkt, kommt es entweder zu einer Phasenbeschleunigung oder einer Phasenverzögerung des endogenen circadianen Rhythmus. So wird er in Phase mit dem Hell-Dunkel-Zyklus der Umgebung gebracht.
  • Weshalb ist ein zeitkompensierter Sonnenkompass für Honigbienen wichtig, und wie beeinflusst er den Schwänzeltanz?

    Lösung

    Der Stand der Sonne kann dazu dienen, die Kompassrichtung einzustellen, wenn man die Tageszeit kennt. Ein zeitkompensierter Sonnenkompass nutzt einen endogenen Zeitgeber, um die Bewegung der Sonne am Himmel zu kompensieren. Wenn eine Honigbiene am Mittag im Süden Nahrung findet, tanzt sie im Stock auf der Wabe so, dass die Schwänzelrunde nach oben weist. Im Lauf des Nachmittags verschiebt sich die Richtung der Schwänzelrunde mehr und mehr nach links, um immer noch anzuzeigen, dass sich die Nahrungsquelle im Süden befindet.
  • Welche Arten der Kommunikation sind für den Informationsaustauch einzelner Individuen am besten geeignet, und welche, wenn ganze Populationen miteinander kommunizieren müssen? Erläutern Sie Ihre Antwort.

    Lösung

    Wenn ein Individuum mit einem anderen kommuniziert, ist eine taktile Kommunikation, die hochspezifisch sein kann, sehr effektiv. Mit visueller Kommunikation kann ein Individuum sehr viele Informationen in kurzer Zeit übermitteln, wenn der Empfänger den Sender sehen kann. Mit akustischen Signalen können größere Populationen effizient kommunizieren, denn Schall breitet sich in der gesamten Umgebung aus. Pheromone eignen sich für die Kommunikation einzelner Individuen oder ganzer Populationen, je nachdem, wie flüchtig die Geruchsstoffe sind.
  • Welche Selektionsdrücke führen dazu, dass sich ein Individuum als Helfer am Nest betätigt, statt sich selbst fortzupflanzen?

    Lösung

    Die Selektion wird ein Individuum bevorzugen, das seinen Eltern bei der Aufzucht der Jungen hilft, wenn seine Chancen gering sind, sich selbst erfolgreich fortzupflanzen. Wenn es mehrere Brüder und Schwestern großzieht, trägt dies stärker zu seiner Gesamtfitness bei.
  • Bei Ameisen und vielen Wespen und Bienen bezeichnet man den Mechanismus zur Geschlechtsbestimmung als Haplodiploidie. Wie wirkt sich dieser Mechanismus auf die Ausbildung von Eusozialität aus?

    Lösung

    Wegen des Geschlechtsbestimmungsmechanismus bei Hymenopteren (Haplodiploidie) teilen Schwestern im Schnitt 75 % ihrer Gene miteinander, während Eltern und ihren Kindern nur 50 % der Gene gemeinsam sind. Die Einheit des Reproduktionserfolgs bei eusozialen Insekten ist die Kolonie, die von einer einzigen Königin gegründet wird. Indem die Arbeiterinnen ihrer Mutter helfen, ihre Schwestern aufzuziehen, teilt eine Arbeiterin im Schnitt 75 % ihrer Gene mit einer neuen Königin. Wenn die neue Königin ihre eigene Tochter wäre, würde sie nur 50 % der Gene mit ihr teilen.
  • Viele kleine Vogelarten greifen gemeinsam größere räuberische Vögel an, um sie zu vertreiben. Welches sind die Risiken und derNutzen dieses Verhaltens? Welche Annahmen können Sie über die Individuen treffen, die sich an einem solchen Verhalten beteiligen?

    Lösung

    Wenn kleine Vögel gemeinsam einen größeren räuberischen Vogel attackieren, ist das Hauptrisiko, dass sie selbst vom Feind angegriffen und verletzt werden. Ein Vorteil des Attackierens ist, dass der Feind von seiner Beute abgelenkt wird, wie den Eiern oder Nestlingen der attackierenden Vögel. Mit diesem Verhalten warnen Vögel außerdem ihre Artgenossen vor dem Feind. Der wesentliche Nutzen besteht natürlich darin, dass der Feind vertrieben wird. Man kann annehmen, dass die an der Attacke beteiligten Vögel wahrscheinlich miteinander verwandt sind. Sie werden sich außerdem mit höherer Wahrscheinlichkeit beteiligen, wenn sie Junge haben. Monogame Männchen werden sich mit höherer Wahrscheinlichkeit beteiligen als promiskuitive.
  • Welcher Unterschied besteht zwischen Ökologie und Ökologismus?

    Lösung

    Unter „Ökologie“ versteht man die Erforschung der Wechselbeziehungen zwischen Organismen und mit ihrer abiotischen Umwelt. Der „Ökologismus“ wendet dieses ökologische Wissen (auch unter Berücksichtigung gesellschaftlicher und ethischer Aspekte) an, wenn es gilt, persönliche und politische Entscheidungen im Zusammenhang mit einem nachhaltigen Umgang mit der Natur zu treffen, erklärt dabei jedoch nicht das Wohl des Menschen, sondern den „Einklang mit der Natur“ zum obersten Ziel.
  • Beschreiben Sie, wie Sie die Hypothese überprüfen würden, dass das verbreitete Sterben des Ockerseesterns (Pisaster ochraceus) durch eine Krankheit verursacht wird. Beziehen Sie dabei Beobachtungen, Experimente und Modelle auf verschiedenen Organisationsebenen ein.

    Lösung

    Man könnte in der Natur Beobachtungen durchführen, ob lebende und tote Seesterne Anzeichen für eine Krankheit zeigen. Sofern man zahlreiche Individuen von verschiedenen Orten untersuchte, könnte man daraus ableiten, ob die betreffende Krankheit auf Populations- oder Metapopulationsebene vorherrscht. Mithilfe eines Experiments könnte man die Seesterne dem vermutlichen Pathogen aussetzen und so feststellen, ob diese von der Krankheit befallen werden. Schließlich könnte man ein Populationsmodell erstellen und damit simulieren, wie sich die Todesfälle durch die Krankheit auf die Seesternpopulationen auswirken, und die Ergebnisse dann mit den erhaltenen Beobachtungsdaten vergleichen.
  • Lässt sich von einem Monat mit extrem heißem Wetter ableiten, dass sich das Klima der Erde erwärmt? Erläutern Sie Ihre Antwort.

    Lösung

    Nein. Ein Monat mit extrem heißem Wetter sagt nicht unbedingt etwas über die Erwärmung des globalen Klimas aus. Als „Klima“ bezeichnet man den langfristigen Durchschnitt der Bedingungen in der Atmosphäre über Jahre bis Jahrmillionen.
  • Warum variiert die Zufuhr an Sonnenenergie in die Erdatmosphäre mit dem Breitengrad? Welche Folgen hat das für das globale Klima?

    Lösung

    Aufgrund der Kugelform der Erde variiert die Intensität der auf der Erdoberfläche auftreffenden Sonnenstrahlung mit dem Breitengrad. In hohen Breiten trifft die ankommende Sonnenenergie in schrägem Winkel ein und muss daher eine größere Distanz der Atmosphäre durchdringen als am Äquator. Dadurch ist die Sonnenstrahlung hier weniger intensiv als am Äquator, wo die Sonnenstrahlen fast senkrecht auf die Erdoberfläche auftreffen. Diese breitengradabhängig variierende Sonneneinstrahlung hat zur Folge, dass es etwa alle 30 Breitengrade zu starken Unterschieden in der Temperatur und den Niederschlägen kommt. Am Äquator herrscht tropisches, feucht-heißes Klima. Am 30. Breitengrad (nördliche und südliche Breite) liegt ein trockenes Klima vor, durch das Wüsten entstehen. Im Bereich des 60. nördlichen und südlichen Breitengrads existiert ein gemäßigtes, feucht-kühles Klima. An den Polen ist das Klima kalt und trocken.
  • Angenommen, Sie wollten ausschließlich durch Windkraft angetrieben von der Ostküste Nordamerikas über den Atlantischen Ozean nach Europa segeln. Beschreiben Sie angesichts der Winde und Meeresströmungen die beste Route hierfür. Welche Route wählen Sie für einen Segeltörn von Nordamerika nach Ostasien?

    Lösung

    Wenn Sie von Nordamerika nach Europa segeln wollten, also von Westen nach Osten, würden Sie wahrscheinlich die Westwinde und den Golfstrom ausnutzen wollen, also in nordöstlicher Richtung über den Atlantischen Ozean segeln. Bei einem Segeltörn von Nordamerika nach Ostasien könnten Sie sich den Nordostpassat und den Nordäquatorialstrom im Pazifik zunutze machen.
  • Erklären Sie, warum auf der Nord- und Südhalbkugel entgegengesetzte Jahreszeiten herrschen.

    Lösung

    Aufgrund der Neigung der Erdachse treffen auf eine bestimmte Region im Laufe eines Jahres, während die Erde die Sonne umkreist, unterschiedliche Mengen an Sonnenlicht auf. Ist die Nordhalbkugel zur Sonne hin geneigt, herrscht dort Sommer; das bedeutet gleichzeitig, dass die Südhalbkugel von der Sonne weg geneigt ist und dort winterliche Bedingungen herrschen.
  • Nennen Sie einige der wichtigsten Auswirkungen der Topographie der Erde auf die physikalischen Bedingungen an Land und in den Meeren.

    Lösung

    Gebirgszüge und Täler können aufgrund ihrer Wirkung auf die Zirkulation in der Atmosphäre lokale und regionale Unterschiede in der Temperatur und den Niederschlägen hervorrufen. Außerdem wirken sie sich auf den Abfluss von Süßwasser in Flüssen und Seen aus. Durch die Topographie des Meeresbodens entstehen unterschiedliche Wassertiefen, was sich wiederum auf das Vordringen des Sonnenlichts, die Wassertemperatur, den Wasserdruck und die Wasserbewegungen (wie Meeresströmungen, Wellen und Gezeiten) auswirkt. Aufgrund dieser Veränderungen der physikalischen Bedingungen entstehen unterschiedliche Meereszonen mit jeweils charakteristischen Biota – ähnlich der terrestrischen Biome.
  • Warum sind Großstädte wärmer als ländliche Gebiete und wie entstehen Stadt-Umland-Winde? Wie und warum könnte man die Temperatur in einer Großstadt durch das Anlegen eines großen bewaldeten Parks verändern?

    Lösung

    Großstädte sind wärmer, weil Beton, Asphalt und die dunklen Dächer von Gebäuden Wärme aus der Sonneneinstrahlung absorbieren und diese Wärme dann in den Abendstunden abstrahlen. Außerdem wird in Großstädten mehr Wärme bei der Verbrennung fossiler Brennstoffe durch Autos, Fabriken und Gebäude erzeugt. Durch die Temperaturdifferenz zwischen Großstädten und den umliegenden ländlichen Gegenden können Stadt-Umland-Winde entstehen: Ausgelöst werden diese Luftbewegungen, wenn aus den Städten aufsteigende warme Luft durch kältere oberflächennahe Luft aus der ländlichen Umgebung ersetzt wird. Parks können durch die Evapotranspiration von Bäumen und anderer Vegetation die Umgebungsluft abkühlen.
  • Beschreiben Sie, anhand welcher Informationen Biome charakterisiert werden. Welche Unterschiede und Ähnlichkeiten bestehen zwischen den Biomen der tropischen Regenwälder und der immergrünen Wälder der gemäßigten Breiten?

    Lösung

    Biome werden anhand von Informationen über die Wuchsformen ihrer dominierenden Pflanzen charakterisiert, denn diese spiegeln die Evolution dieser Pflanzen unter den dort jährlich herrschenden Temperaturen und Niederschlägen wider. Tropische Regenwälder kommen in den Regionen am Äquator unter beständig feucht-warmen Bedingungen vor. Die vorherrschenden Pflanzen sind tropische Baumarten mit bis zu 500 Spezies pro Quadratkilometer. Immergrüne Wälder der gemäßigten Zone wachsen dagegen in mittleren bis hohen Breiten mit milden, feuchten Wintern und warmen, trockenen Sommern. Die dominanten Baumarten bilden eine Handvoll Koniferen. Die beiden Waldtypen ähneln sich insofern, als sie beide unter feuchten Bedingungen gedeihen und die Bäume ihre Blätter bzw. Nadeln nicht jahreszeitlich abwerfen.
  • Erläutern Sie warum die Wallace-Linie mitgeholfen hat zu erklären, wie es zur Ausbildung biogeographischer Regionen kommt.

    Lösung

    Wallace erkannte, dass die beiden benachbarten Inseln Bali und Lombok von äußerst unterschiedlichen terrestrischen Arten bewohnt sind, obwohl sie nur 24 km voneinander entfernt liegen und jeweils ähnliche physikalische Bedingungen herrschen. Aufgrund dieser Beobachtung formulierte er die Hypothese, dass die unterschiedlichen Biota durch eine Ausbreitungsbarriere voneinander getrennt worden sein mussten (in diesem Fall ein tiefer Meeresgraben) und diese Trennung über die entwicklungsgeschichtliche Zeit aufrechterhalten blieb. Wallace äußerte die Vermutung, die biogeographischen Regionen seien das Ergebnis der Isolation der auf verschiedenen Kontinenten oder Inseln lebenden Arten.
  • Im Laufe der Erdgeschichte erstreckte sich die Eisdecke mehrmals bis in die gemäßigten Breiten. Stützt diese Tatsache eher die Hypothese der unterschiedlichen Artbildungsrate oder die Hypothese des unterschiedlichen Artbildungszeitraums, die zur Erklärung der breitengradabhängigen Variation der Artenvielfalt erstellt wurden? Erläutern Sie Ihre Antwort.

    Lösung

    Die Tatsache, dass sich die Eisdecke bis in die gemäßigten Regionen erstreckte, wo die Artenvielfalt gegenwärtig geringer ist als in den Tropen, stützt eher die Hypothese des unterschiedlichen Artbildungszeitraums. Dieser Hypothese zufolge stand in den Tropen mehr Zeit für Artbildungsereignisse zur Verfügung, weil dort keine harschen klimatischen Bedingungen auftraten, welche die Artbildungsrate beschleunigten oder die Aussterberate erhöhten. Somit haben sich in den Tropen ganz einfach deswegen mehr Arten angesammelt, weil hier keine größeren klimatischen Veränderungen stattfanden.
  • Erläutern Sie, wie es dazu kommt, dass auf den kleinen, entfernten Inseln eine geringere Zahl von Arten vorkommt als auf den großen, nahe gelegenen.

    Lösung

    Die Theorie der Inselbiogeographie geht davon aus, dass die Zahl der Arten auf einer Insel ein Gleichgewicht darstellt zwischen der Zuwanderungsrate und der Aussterberate. Auf eine weiter vom Artenpool entfernt liegende Insel werden weniger Arten zuwandern als auf eine näher gelegene. Zudem werden auf einer kleineren Insel weniger Ressourcen verfügbar sein, sodass dort weniger Arten leben können und die Aussterberate höher ist. Größere Inseln bieten mehr Ressourcen und können größere Populationen beherbergen (die zumeist durch niedrigere Aussterberaten gekennzeichnet sind als kleinere Populationen).
  • Warum stellt die Fragmentierung von Habitaten durch Aktivitäten des Menschen eine Bedrohung für die Artenvielfalt dar? Wie könnte man diese Gefahr verringern, ohne die Aktivitäten völlig einzustellen?

    Lösung

    Durch Habitatfragmentierung entstehen letztendlich isolierte Habitatinseln, die von Arealen umgeben sind, die sich nicht als Habitat eignen. Je kleiner und stärker isoliert ein Habitatfragment ist, desto weniger Arten können darin leben und desto geringer ist die Wahrscheinlichkeit, dass Arten in geeignetere Fragmente abwandern können. Zudem kann das Fragment auch noch Randeffekten ausgesetzt sein – Gefahren von außerhalb des Fragments, die dessen Größe faktisch verringern. Verringern lassen sich die Auswirkungen der Habitatfragmentierung, indem man Fragmente unberührt lässt, die groß genug für den Erhalt der Arten sind, oder indem man Korridore schafft, durch welche die Arten ungefährdet von einem Fragment zum anderen gelangen können.
  • Nennen Sie einige Methoden, mit denen man die Größe und die geographische Ausdehnung einer Population von Organismen ermitteln kann?

    Lösung

    Mit folgenden Methoden lässt sich die Größe von Populationen abschätzen: vollständige Bestandserhebung (Zensus), Rasterkartierungen oder Kartierungen entlang von Transekten, die Fang-Wiederfang-Methode und DNA-Analysen.
  • Eine Wissenschaftlerin möchte herausfinden, wie viele Leopardfroschkaulquappen im Frühling in einem Teich leben. Später, nach der Metamorphose der Kaulquappen, möchte sie diese Zahl mit der Größe der Froschpopulation vergleichen. Welche Methode sollte sie am besten anwenden, um die Populationsgröße zu ermitteln? Erläutern Sie Ihre Antwort.

    Lösung

    Am geeignetsten wäre vermutlich die Fang-Wiederfang-Methode. Raster- und Transektkartierungen eignen sich lediglich für Pflanzen, Pilze oder sessile Tiere. In einem großen Gebiet oder im freien Wasser ist es sehr schwierig oder unmöglich, eine vollständige Bestandserhebung mobiler Tiere durchzuführen. Bei diesen ist es zumeist am besten, als Stichprobe eine Anzahl von Individuen einzufangen, diese zu markieren, wieder freizulassen, nach einiger Zeit eine weitere Stichprobe zu fangen und unter diesen Tieren die erneut gefangenen Individuen zu zählen. Auf diese Weise lässt sich die Populationsgröße recht realistisch abschätzen.
  • Erstellen Sie eine Gleichung, die beschreibt, wie sich Geburten, Sterbefälle, Zu- und Abwanderungen von Individuen auf die Größe einer Population auswirken. Definieren Sie jede der Variablen.

    Lösung

    Nt = N0 + (BD) + (IE)
    Nt= Populationsgröße zum Zeitpunkt t;
    Nt = Populationsgröße zum Zeitpunkt 0;
    B = Zahl der zwischen Zeitpunkt 0 und Zeitpunkt t geborenen Individuen;
    D = Zahl der zwischen Zeitpunkt 0 und Zeitpunkt t gestorbenen Individuen;
    I = Zahl der zwischen Zeitpunkt 0 und Zeitpunkt t zugewanderten Individuen;
    E = Zahl der zwischen Zeitpunkt 0 und Zeitpunkt t abgewanderten Individuen.
  • Warum sind Arten nicht dazu in der Lage, bei Wachstum, Fortpflanzung und Überleben das jeweilige Optimumzu erreichen? Anders ausgedrückt, warum gibt es trade-offs(Kompromisse) bei Lebenszyklusstrategien?

    Lösung

    Zu trade-offs (Kompromissen) bei den Lebenszyklen kommt es, weil Einschränkungen eine Optimierung verhindern. Zu solchen Einschränkungen gehören die verfügbare genetische Variabilität, aber auch die strukturellen und funktionellen körperlichen Gegebenheiten sowie die abiotischen und biotischen Umweltbedingungen. Beispielhaft für solche trade-offs ist die Aufteilung von Ressourcen, wodurch Kompromisse zwischen starkem Wachstum und hoher Fortpflanzungsrate oder hoher Fortpflanzungsrate und Überlebenswahrscheinlichkeit entstehen.
  • Beschreiben Sie eine wirkungsvolle Strategie, mit der man erreichen könnte, dass sich der Bestand einer erwünschten Art, die gemäß ihres Lebenszyklus als K-Stratege einzuordnen ist, wieder erholt.

    Lösung

    Arten, die aufgrund ihres Lebenszyklus als K-Strategen einzuordnen sind, pflanzen sich erst ab einer gewissen Größe fort und produzieren über einen längeren Zeitraum weniger Nachkommen als r-Strategen. Infolgedessen können es Managementmaßnahmen für eine Bestandserholung erforderlich machen, die Zahl oder Größe der Individuen innerhalb der Population zu berücksichtigen, damit die Individuen lange genug leben und/oder groß genug werden, um sich überhaupt erfolgreich mit einer Rate fortpflanzen zu können, die mit der Zeit eine Zunahme der Population ermöglicht.
  • Ordnen Sie die folgenden interspezifischenWechselbeziehungen den Kategorien Carnivorie, Herbivorie, Parasitismus, interspezifische Konkurrenz, Probiose, Symbiose oder Amensalismus zu.
    a. Blattschneiderameisen ernten Blattstücke und transportieren diese in ihre Nester; dort wächst auf dem pflanzlichen Material ein Pilz, von dem sich die Ameisen ernähren.
    b. See-Elefanten zerquetschen auf Felsen wachsende Algen oder reißen diese ab, wenn sie auf den Felsen liegen.
    c. Kopfläuse leben auf der Kopfhaut von Menschen und ernähren sich von Blut.
    d. Wölfe und Pumas erbeuten Hirsche aus derselben, für beide Räuber begrenzten Population.

    Lösung

    a. Herbivorie und Symbiose
    b. Amensalismus
    c. Parasitismus
    d. interspezifische Konkurrenz
  • Zählen Sie einige Bedingungen auf, die Einfluss auf den Ausgang einer Wechselbeziehung von zwei Arten haben und diesen verändern können.

    Lösung

    Unter anderem können abiotische Faktoren, biotische Faktoren, zum Beispiel die Verbreitung, und andere interagierende Arten zu einer Veränderung einer Wechselbeziehung zwischen zwei Spezies führen.
  • Was denken Sie: Haben die Interaktionen zwischen den Rotfeuerfischen und ihren Beutefischen im Atlantischen Ozean zu evolutionären Veränderungen bei den Beutearten geführt? Erläutern Sie Ihre Antwort.

    Lösung

    Nein, wahrscheinlich reichte dafür die Zeit nicht aus: In der relativ kurzen Zeit konnten sich die Beutearten der Rotfeuerfische im Atlantik wohl kaum durch Evolution an ihre neuen Feinde anpassen.
  • Beschreiben Sie anhand ihrer Kenntnisse über das Beutefangverhalten von Rotfeuerfischen einige Mechanismen, die sich bei kleinen Rifffischen im Atlantik zur Feindvermeidung herausbilden könnten, damit sie den Rotfeuerfischen nicht zum Opfer fallen.

    Lösung

    Das vielleicht einfachste Verhalten, das die Rifffische zeigen könnten – oder das bei ihnen evolvieren könnte –, bestünde darin zu vermeiden, dass die Rotfeuerfische sie mit dem Kopf voran schnappen. Dazu müssten sie eine Möglichkeit entwickeln, die Anwesenheit eines Rotfeuerfischs zu bemerken und vor dem Räuber zu fliehen, bevor dieser seinen Wassersstrahl erzeugen und von vorne zuschnappen kann. Oder die Beutefische müssten, wenn sie von einem Wasserstrahl getroffen wurden, unvorhersehbare Schwimmbewegungen vollführen, um ein frontales Zuschnappen zu vermeiden.
  • Welche Merkmale von Herbivorie und Parasitismus begünstigen wahrscheinlich eine Spezialisierung?

    Lösung

    Sowohl Herbivorie als auch Parasitismus sind gekennzeichnet durch ein enges Zusammenleben, wobei viele Herbivoren kleiner sind als ihre Futterpflanzen und die Parasiten kleiner sind als ihre Wirte und sie mitunter auf diesen leben. Diese enge Beziehung führt von Natur aus dazu, dass die beteiligten Arten spezielle Mechanismen entwickeln, um den Auswirkungen der jeweils anderen entgegenzusteuern. Die Beute von Herbivoren bilden Pflanzen, die nicht zur Fortbewegung fähig sind und daher mitunter als Reaktion auf potenziell starke Herbivorie besondere Abwehrmechanismen entwickeln.
  • Angenommen, die Anzahl der Grasarten auf einer alpinen Wiese werde durch die Herbivorie durch Hasen aufrechterhalten. Die Hasen ernähren sich von der räumlich dominierenden Art und ermöglichen es dadurch weniger dominanten Grasarten, hier vorzukommen (ähnlich wie in dem Beispiel mit den Seesternen und Miesmuscheln). Nehmen Sieweiterhin an, in dem Ökosystem würden Luchse als Prädatoren angesiedelt. An welcher Stelle im Populationszyklus von Luchsen und Hasen wird die Anzahl der Grasarten ihrer Ansicht nach am höchsten sein? Und wann am niedrigsten?

    Lösung

    Am höchsten wäre die Zahl der Grasarten auf dem Höhepunkt der Hasenpopulation, am niedrigsten, wenn die Hasenpopulation ihr Minimum erreicht hat.
  • Die fundamentale Nische des heimischen Europäischen Eichhörnchens (Sciurus vulgaris) umfasst ganz Großbritannien. Seit der Einführung eines hier nicht natürlich vorkommenden Konkurrenten, des nordamerikanischen Grauhörnchens (Sciurus carolinensis), beschränkt sich die Verbreitung des Eichhörnchens auf Irland und die nördlichen Regionen Schottlands. Wie hat sich die realisierte Nische des Eichhörnchens infolge der interspezifischen Wechselbeziehungen mit den Grauhörnchen verändert?

    Lösung

    Eine realisierte Nische wird durch die Wechselbeziehungen einer Art mit anderen Spezies festgelegt. Aufgrund der Konkurrenz durch die Grauhörnchen hat sich die realisierte Nische des Europäischen Eichhörnchens verkleinert.
  • Angenommen, Sie teilen sich mit einer Freundin einen Milch-Shake und haben beide einen Trinkhalm. In Szenario 1 trinken Sie beide mit dem Trinkhalm und konsumieren so den ganzen Milch-Shake gemeinsam. In Szenario 2 nimmt Ihre Freundin beide Trinkhalme und trinkt den gesamten Milch-Shake leer. Welches Szenario ist ein Beispiel für Interferenz-und welches eines für Ausbeutungskonkurrenz?

    Lösung

    Szenario 1 ist ein Beispiel für Ausbeutungskonkurrenz, weil Sie und Ihre Freundin sich die Ressource, den Milch-Shake, teilen. Szenario 2 ist ein Beispiel für Interferenzkonkurrenz, weil Ihre Freundin Sie von der Ressource ausschließt.
  • Nennen Sie mögliche Gründe dafür, warum bestäubende Insekten und samenverbreitende Tiere wohl eine obligate bzw. fakultative Symbiose mit Pflanzen ausbilden.

    Lösung

    Eine obligate Symbiose entwickelt sich, wenn beide an der Interaktion beteiligten Arten voneinander jeweils mehr profitieren als von anderen potenziellen Partnern. Eine fakultative Symbiose entsteht, wenn die beiden daran beteiligten Arten von Partnerschaften mit mehreren Arten profitieren. Sofern beispielsweise mehrere Arten Pollen oder Samen an die gewünschten Orte transportieren können, werden sich eher fakultative Beziehungen ausbilden.
  • In welchem Bereich der Gezeitenzone der Felsküste könnten Seepocken der Gattung Semibalanus von positiven Interaktionen mit anderen Arten profitieren? Und wie sieht das bei Chthamalus aus? Erläutern Sie Ihre Antwort.

    Lösung

    Beide Seepockenarten werden mit höherer Wahrscheinlichkeit unter den stressreicheren Bedingungen im oberen Bereich der Gezeitenzone, wo es zu Austrocknung kommen kann, von positiven Interaktionen profitieren.
  • Erläutern Sie anhand eines Beispiels, wie sich Spezies, die anderen einen Lebensraum bieten, auf die Artenzahl in einer Biozönose auswirken können.

    Lösung

    Beispiele sind unter anderem Bäume, Korallenriffe und Tangwälder. Die Habitate, die diese Arten bieten, begünstigen zahlreiche andere von ihnen abhängige Spezies.
  • Warum werden Biozönosen anhand von Artengruppen abgegrenzt? Welcher Form von Artengruppe gehörten die Frösche und Kröten in den Teichen vom Mount St. Helens an?

    Lösung

    Man verwendet Artengruppen zur Beschreibung von Biozönosen, weil es nicht praktikabel ist, jede Art einer Lebensgemeinschaft zu berücksichtigen. Dafür gibt es mindestens zwei Gründe: Erstens unterliegen Biozönosen räumlichen und zeitlichen Veränderungen, sodass es schwierig ist, sie eindeutig abzugrenzen. Und Zweitens erweist es sich als unmöglich, jede Art einer Biozönose zu identifizieren, weil viele davon einfach noch gar nicht beschrieben sind. Zahlreiche Bakterien, Mikroorganismen und kleine Wirbellose sind schwierig zu entdecken, ganz zu schweigen davon, sie zu identifizieren oder gar ihre Ökologie zu erforschen
    Die Frösche und Kröten vom Mount St. Helens bilden eine nach taxonomischer Zusammengehörigkeit zusammengefasste Artengruppe – alle Arten gehören einem Taxon an, den Amphibien.
  • Welcher Faktor hat die am stärksten einschränkende Wirkung auf die Artenzusammensetzung der lokalen Biozönose? Erläutern Sie Ihre Antwort.

    Lösung

    Am stärksten einschränkend wirken sich die Ausbreitungsfähigkeit und Zuwanderung von Spezies auf die Artenzusammensetzung der lokalen Biozönose aus. Den Filter des Zustroms von Arten haben sieben Spezies nicht passiert, durch den abiotischen Filter wurden vier Arten, durch den biotischen Filter wurden drei Arten ausgesiebt.
  • Angenommen, sie müssten versuchen, am Mount St. Helens die Besiedlung durch nichtheimische Arten einzudämmen. Mit welcher allgemeinen Managementmaßnahme könnten Sie das wahrscheinlich am besten erreichen?

    Lösung

    Wenn man davon ausgeht, dass der Filter des Artenzustroms am wirkungsvollsten Arten aus einer lokalen Biozönose ausschließt, sollte man als Strategie wählen, so viele nichtheimische Spezies wie möglich daran zu hindern, überhaupt erst in das Gebiet an diesem Berg vorzudringen.
  • Angenommen, es würde erneut dazu kommen, dass es im Yellowstone-Nationalpark keine Wölfe mehr gibt. Welche direkten und indirekten Interaktionen würden sich dadurch verändern und wie würde sich das auf die Espenwälder auswirken?

    Lösung

    Für die Wapitihirsche würde die direkte Interaktion in Form der Prädation durch die Wölfe entfallen und ihre Zahl würde steigen. Durch den Anstieg der Hirschpopulation würde der Beweidungsdruck auf die Espen zunehmen und ihre Zahl würde zurückgehen. Das Fehlen der Wölfe würde sich also indirekt auch auf die Espen auswirken. Ein geringerer Bestand an Espen würde noch weitere indirekte Auswirkungen der ausbleibenden Prädation durch Wölfe nach sich ziehen: weniger Schneeschuhhasen, Biber und andere Nagetiere, welche auf die Espen als Nahrung angewiesen sind. Geringere Bestände kleiner Herbivoren könnten sich wiederum auf andere Carnivoren des Ökosystems wie Kojoten, Kolkraben und Hermeline auswirken.
  • Versuchen Sie zu erklären, warum man Biber als Ökosystemingenieure wie auch als Schlüsselarten, aber nicht als Gründerarten betrachten kann.

    Lösung

    Auf Biber passt am besten die Definition für Ökosystemingenieure, weil sie Bäume fällen, damit Fließgewässer aufstauen und so Teiche und Feuchtgebiete schaffen, die ihnen selbst und anderen Arten einen Lebensraum bieten; sie sind also in der Lage, neue physikalische Habitate zu schaffen, diese zu verändern und zu erhalten. Man könnte Biber jedoch auch als Schlüsselarten betrachten, weil sie im Verhältnis zu ihrer Größe oder Häufigkeit einen ziemlich großen Einfluss auf die Biozönose haben. Allerdings geht man davon aus, dass Schlüsselarten ihre Wirkung hauptsächlich über Nahrungsnetze entfalten, indem sie trophische Kaskaden erzeugen. Als Gründerart würde man Biber nicht ansehen, weil solche Spezies ihre Wirkung auf Biozönosen durch einen besonders großen Körper oder ein häufiges Vorkommen entfalten. Das ist aber reine Definitionssache.
  • Erklären Sie anhand des Neutralmodells, wie es zu einer Coexistenz von Arten kommen kann, die auf die gleichen begrenzten Ressourcen angewiesen sind.

    Lösung

    Ein Neutralmodell besagt Folgendes: In Biozönosen, in denen Arten ähnliche begrenzte Ressourcen nutzen und sich untereinander auf ähnliche Weise beeinflussen, bildet das Element der Chancengleichheit aller Individuen, diese Ressourcen zu nutzen, die Grundlage für eine Coexistenz. Voraussetzung für dieses Modell ist, dass verfügbar gewordene Ressourcen nach dem Zufallsprinzip von den Individuen verschiedener Artengenutzt werden, die zufällig „zum richtigen Zeitpunkt am richtigen Ort" sind. Solange alle Individuen ähnliche Chancen haben, die Ressourcen zu nutzen und sich kein eindeutiger Vorteil bezüglich des Populationswachstums ergibt, sollten sie aufgrund von Zufallsereignissen, welche diese Ressourcen für die darum konkurrierenden Individuen verfügbar machen, Bestandteil der Biozönose bleiben.
  • Wie unterscheidet sich eine Störung von Stress?

    Lösung

    Von einer Störung spricht man bei einem abiotischen Ereignis, durch das einige Individuen physikalisch oder chemisch geschädigt oder sogar getötet werden, wodurch sich für andere Arten Gelegenheiten eröffnen, zu wachsen und/oder sich fortzupflanzen. Zu solchen Störungen zählen beispielsweise Wirbelstürme, Waldbrände und Vulkanausbrüche. Unter Stress versteht man, wenn sich abiotische Faktoren negativ auf das Wachstum, die Fortpflanzung und letztendlich auf das Überleben von Individuen auswirken. Dürre oder extreme Kälte können zum Beispiel bei Organismen Stress hervorrufen.
  • Nennen Sie einige biotische Faktoren, die in Biozönosen Veränderungen hervorrufen.

    Lösung

    Zu biotischen Faktoren, die in Biozönosen Veränderungen hervorrufen, gehören beispielsweise interspezifische Wechselbeziehungen wie Prädation, Konkurrenz oder Krankheiten. Des Weiteren kommen mechanische Schädigungen durch Organismen hinzu wie Zertrampeln oder Umgraben.
  • „Eine Primärsukzession wird ausschließlich durch ökologische Förderung reguliert." Ist diese Aussage richtig oder falsch? Erläutern Sie Ihre Antwort.

    Lösung

    Sie ist falsch. Eine Primärsukzession wird sowohl durch förderliche als auch durch hemmende Prozesse reguliert, die gemeinsam im Laufe der Zeit einwirken. Das Fortschreiten einer Sukzession ist abhängig von den Erstbesiedlern, die sich auf später eintreffende Arten förderlich oder hemmend auswirken können. In der Glacier Bay in Alaska ermöglichten beispielsweise die Silberwurz und Erlen, dass sich Fichten ansiedeln konnten. Im späteren Verlauf der Sukzession führte die Konkurrenz durch die Fichten jedoch dazu, dass die Arten der frühen Sukzessionsstadien im Bestand wieder zurückgingen.
  • Wie kommt es zu einem Alternativzustand einer Biozönose bzw. einem Regime- oder Zustandswechsel?

    Lösung

    Zu einem Alternativzustand bzw. einem Regime- oder Zustandswechsel einer Biozönose kommt es, wenn eine Störung oder Stress zur Folge haben, dass die Sukzession anders verläuft. Als Beispiele für solche Alternativzustände könnte man unter anderem die Ausrottung und anschließende Wiederansiedlung der Wölfe in den Espenwäldern des Yellowstone-Nationalparks, das Vorkommen oder Fehlen von Seeottern in den Riesentangwäldern entlang der nordamerikanischen Westküste und die Auswirkungen von Bibern auf Feuchtgebiete im US-Bundesstaat Minnesota anführen.
  • Warum bauen die Bauern in Costa Rica auf den gleichen Feldern häufig mehrere verschiedene Nutzpflanzen an, und warum könnte sich diese Strategie auch unter ariden (trockenen) Bedingungen als vorteilhaft erweisen?

    Lösung

    Die Bauern in Costa Rica bauen häufig mehrere Nutzpflanzen (wie Mais und Süßkartoffeln) gemeinsam an, weil die Pflanzen dann von einer geringeren Zahl von Schadinsekten befallen werden. So lockt beispielsweise der Pollen von Mais Schlupfwespen an; diese Schlupfwespen greifen aber als Parasitoide wiederum die Larven von Süßkartoffelschädlingen an, wovon die angebauten Süßkartoffeln profitieren. Auch die Maispflanzen profitieren, weil sie durch die Schlupfwespen bestäubt werden.
    Unter trockenen Bedingungen könnte sich der Anbau von Polykulturen als erfolgreiche Maßnahme erweisen, wenn jede der angebauten Arten bei Wassermangel etwas unterschiedlich gedeiht. Kommt beispielsweise eine Art damit besser zurecht als eine andere, so könnte die Produktivität insgesamt dennoch hoch sein verglichen mit einer Monokultur aus nur einer Art, die nicht besonders gut bei Trockenheit gedeiht.
  • Eine Ökologin ermittelt die Zahl der in einem Ökosystem vorkommenden Arten. Betreibt sie Ökosystemforschung? Erläutern Sie Ihre Antwort.

    Lösung

    Nicht unbedingt. Die Ökosystemforschung befasst sich mit den Energieflüssen und Stoffkreisläufen in Ökosystemen. Die Anzahl der Arten liefert eine Beschreibung der biotischen Umwelt, aber keinerlei Informationen über Energieflüsse und Stoffkreisläufe eines Ökosystems.
  • Beschreiben Sie, auf welchen zwei Wegen Energie und Kohlenstoff in die Primärproduktion einfließen.

    Lösung

    Energie und Kohlenstoff können durch Photosynthese und Chemosynthese in die Primärproduktion eingehen. Bei der Photosynthese nehmen Landpflanzen, Algen und Cyanobakterien die Energie des Sonnenlichts auf und fixieren damit Kohlenstoff aus CO2 in organischen Verbindungen. Bei der Chemosynthese absorbieren Archaeen und Bakterien die Energie aus anorganischen Verbindungen, um Kohlenstoff aus CO2 in organischen Verbindungen zu fixieren. Chemosynthese findet gewöhnlich in Ökosystemen wie hydrothermalen Tiefseeschloten, heißen Quellen und Böden statt, wo es kein Sonnenlicht gibt, aber bestimmte energiereiche anorganische Verbindungen in hohen Konzentrationen vorliegen.
  • Welche Unterschiede bestehen in der NPP im offenen Meer gegenüber Algenrasen, Seegraswiesen und Korallenriffen? Warum ist der Prozentsatz der NPP für das offene Meer global gesehen so viel höher?

    Lösung

    Die durchschnittliche Nettoprimärproduktivität ist im offenen Meer im Vergleich zu Algenrasen, Seegraswiesen und Korallenriffen (1500 g/m2/Jahr) sehr viel geringer (ca. 100 g/m2/Jahr). Aufgrund der enormen Ausdehnung der offenen Meere (nahezu 70 % der Erdoberfläche), im Gegensatz Algenrasen, Seegraswiesen und Korallenriffen (nur 0,1 % der Erdoberfläche), haben erstere insgesamt für einen viel höheren Anteil an der globalen NPP.
  • Der CO2-Gehalt der Atmosphäre nimmt mit bislang einzigartiger Geschwindigkeit zu. Ist es plausibel, davon auszugehen, dass es den Primärproduzenten an Land und in den Meeren gelingen wird, die globale CO2-Konzentration nennenswert zu senken? Welche Belege stützen Ihre Antwort?

    Lösung

    Nein, die Primärproduzenten werden nicht in der Lage sein, die globale CO2-Konzentration nennenswert zu verringern. Wie Experimente mit künstlicher Erhöhung der CO2-Konzentration gezeigt haben, können Primärproduzenten zwar ihre NPP bei erhöhtem Gehalt an CO2 steigern, aber nur innerhalb gewisser Grenzen. Diese Grenzen setzen andere limitierende Faktoren wie die Verfügbarkeit von Nährelementen, Licht und Wasser. Kontraproduktiv könnte sich zudem der Ausstoß von CO2 durch die Atmung der Konsumenten auswirken, die sich von den Primärproduzenten ernähren.
  • Beschreiben Sie den Vorgang der Eutrophierung. Welches Nährelementhat in Seeökosystemen den größten Einfluss auf diesen Prozess?

    Lösung

    Eine Eutrophierung muss zwar nicht zwangsläufig, kann aber ein explosionsartiges Algenwachstum zur Folge haben. Wenn diese Algen absterben, kann ihre Zersetzung zu einem erheblichen Sauerstoffmangel (hypoxische Bedingungen) führen. Die Intensität dieser hypoxischen Bedingungen hängt von der Menge der zersetzten Algen und der in dem Ökosystem verfügbaren Menge an Sauerstoff ab.
  • Betrachten Sie zwei fiktive Nahrungsnetze, eines in einem Wald, das andere in einem See. Welches dieser Nahrungsnetze wird unter ansonsten gleichen Bedingungen die höhere trophische Effizienz aufweisen und warum? Und wenn Sieeinen Krebs und einen Bären betrachten: Welches Tier wird sich durch eine höhere Produktionseffizienz auszeichnen? Erläutern Sie Ihre Antworten.

    Lösung

    Das Nahrungsnetz des Sees wird die höhere trophische Effizienz aufweisen. In Waldökosystemen ist die trophische Effizienz geringer als in aquatischen Ökosystemen, weil in Wäldern ein Großteil der NPP in Form von Holz vorliegt und damit nicht für Konsumenten verfügbar ist. Ein Nahrungsnetz in einem See beruht dagegen auf Phytoplanktonorganismen und Makroalgen, die im Gegensatz zu Holz problemlos in die Sekundärproduktion eingehen. Schätzungen zufolge werden an Land im Schnitt lediglich 13 % der Biomasse von Herbivoren konsumiert, in aquatischen Ökosystemen sind es dagegen 35 %. Ein Krebs wird als ektothermes Tier eine höhere trophische Effizienz aufweisen als der endotherme Bär. Endotherme müssen eine höhere Stoffwechselrate aufrechterhalten als Ektotherme, sodass sie weniger Energie in Wachstum und Fortpflanzung investieren können.
  • Vergleichen Sie nun zwei Nahrungsnetze in verschiedenen Seen. Eines davon umfasst drei Trophiestufen, das andere vier. In welchem der Nahrungsnetze wird unter ansonsten gleichen Bedingungen die höhere NPP zu verzeichnen sein und warum? Wenn auf der höchsten Ebene des Nahrungsnetzes aus vier Ebenen noch Omnivorie hinzukäme, inwiefern würde seine NPP dann im Vergleich zu dem Nahrungsnetz ohne Omnivorie abweichen?

    Lösung

    In dem See mit drei Trophiestufen wird die NPP höher sein. Ein Nahrungsnetz aus drei Stufen, in dem sich die Spitzenräuber auf die Häufigkeit der Herbivoren auswirken, sollte eine höhere NPP aufweisen als ein Netz, das zwei oder vier Trophiestufen umfasst, denn in diesen werden die Herbivoren nicht so stark von den Carnivoren reguliert. Omnivorie kann sich ebenfalls auf die Energieübertragung in Nahrungsnetzen auswirken, weil Trophiestufen aufgeweicht dadurch werden. In einem Nahrungsnetz aus vier Stufen, in dem sich ein Spitzenräuber sowohl von Herbivoren als auch von Primärproduzenten ernährt, sollte eine geringere NPP zu verzeichnen sein als in einem Nahrungsnetz aus vier Stufen ohne Omnivorie. Zwar begünstigt der Spitzenräuber indirekt die Primärproduzenten, weil er die Zahl der Herbivoren dezimiert, aber dieser Effekt wird teilweise dadurch wieder aufgehoben, dass er auch Primärproduzenten vertilgt.
  • Vergleichen Sie ein Nahrungsnetz aus fünf Trophiestufenin einem tropischen Regenwald mit einem aus drei Stufenin einer Wüste. Mit welcher Hypothese lässt sich die unterschiedliche Länge der Nahrungsketten in diesen beiden Ökosystemen am besten erklären?

    Lösung

    Einer Hypothese zufolge reguliert die NPP, die in ein Ökosystem eintritt, die Anzahl von dessen Trophiestufen (Bottom-up-Kontrolle, also durch von unten nach oben wirkende Faktoren). Weil die NPP in tropischen Regenwäldern höher ist als in Wüsten, können hier mehr Trophiestufen versorgt werden, denn hier kommt eine größere Menge an Energie bei den Populationen höherer Trophiestufen an.
  • In Organismen, Böden und Flüssen hat ein Wassermolekül eine kurze Verweildauer, in Seen, Gletschern und Meeren dagegen eine viel längere. Warum ist das der Fall?

    Lösung

    Die Verweildauer von Wasser hängt davon ab, mit welcher Rate es von einem Reservoir zum nächsten gelangt. In Organismen, Böden und Flüssen ist die Verweildauer aufgrund ihrer im Vergleich zu Seen, Gletschern und Meeren relativ geringen Wassermengen jeweils kurz, denn das Wasser gelangt recht schnell in eines der anderen Reservoirs.
  • Warum steigt der Gehalt an CO2 in der Atmosphäre und in den Meeren an und wie wirkt sich dieser CO2-Anstieg auf das Klima und die Chemie der Meere aus?

    Lösung

    Der CO2-Gehalt in der Atmosphäre und in den Meeren steigt wegen der Verbrennung fossiler Brennstoffe an. Derzeit erreicht die atmosphärische CO2-Konzentration etwas über 400 ppm und damit den höchsten Wert in den letzten 800.000 Jahren. CO2 wirkt als Treibhausgas, wird zusammen mit anderen Treibhausgasen beim Verbrennen fossiler Brennstoffe freigesetzt und hat zu einem Anstieg der globalen Temperatur geführt. In den letzten 100 Jahren ist die globale Temperatur durch die Zunahme der CO2-Konzentration um ungefähr 1 °C angestiegen.
    Etwas weniger als die Hälfte des bei der Verbrennung fossiler Brennstoffe freigesetzten CO2 wird von den Meeren aufgenommen und reagiert mit dem Meerwasser zu Kohlensäure (H2CO3). Mit steigendem Kohlensäuregehalt des Meerwassers sinkt durch die Dissoziation in Protonen und Hydrogencarbonationen der pH-Wert. Diese zunehmende Versauerung kann sich auf viele marine Organismen mit Kalkskeletten oder Kalkschalen negativ auswirken.
  • Erläutern Sie, inwiefern im Stickstoffkreislauf biologische Vorgänge dominieren, im Phosphor- und Schwefelkreislauf dagegen geochemische Prozesse.

    Lösung

    Stickstoff tritt als atmosphärisches Gas (N2) in das biotische System ein und wird von Bakterien in Form von Ammoniak (NH3) fixiert. Ammoniak wird rasch in Ammoniumionen (NH4+) umgewandelt, die von Pflanzen und Bakterien aufgenommen werden können. Nitrifizierende Bakterien können Ammoniumionen in Nitrit (NO2-) und Nitrat (NO3-) und damit weitere von Pflanzen und Bakterien verwertbare Formen umwandeln. Denitrifizierende Bakterien nehmen das Nitrat auf und verwandeln es in die Gase N2 und Distickstoffmonoxid (N2O) um, die dann wieder in die Atmosphäre freigesetzt werden. Diese mikrobielle Verarbeitung von Stickstoff erfolgt sehr rasch und macht rund 95 % des gesamten Stickstoffflusses auf der Erde aus. Somit ist die Triebfeder des Stickstoffkreislaufs überwiegend biologischer Natur.
    Im Gegensatz zu Stickstoff sind Phosphor und Schwefel vor allem in Gesteinen und Tiefseesedimenten enthalten. Ihr Kreislauf durch das geologische System erfolgt sehr langsam, weil dazu die Bildung von Sedimentgesteinen, eine Anhebung des Meeresbodens und Verwitterung erforderlich sind. Wurden diese Elemente dann allerdings von Organismen aufgenommen, so kreisen sie rasch durch die biologischen Komponenten des Ökosystems.
  • Mangroven bieten Küsten Schutz vor extremer Brandung und Stürmen, liefern Rohstoffe wie Holz und Naturfasern, schützen vor Erosion, reinigen das Wasser, bieten Lebensräume für Jungfische, binden Kohlenstoff und bieten einen Ort für Erholung, Bildung und Tourismus. Ordnen sie jede dieser Ökosystemleistungen einer der vier Kategorien zu.

    Lösung

    Holz und Naturfasern gehören zu den bereitstellenden Ökosystemleistungen, Küsten- und Erosionsschutz sind regulierende Leistungen, die Reinigung des Wassers, Lebensraum für Fische und die Fixierung von Kohlenstoff zählen zu den unterstützenden Leistungen, Erholung, Bildung und Tourismus sind als kulturelle Leistungen einzustufen.
  • Angenommen, Sie hätten sich zum Ziel gesetzt, den optimalen Küstenschutz, den Mangroven bieten, mit der Garnelenzucht in Aquakulturen verbinden (wozu allerdings die Mangrovenbäume gerodet werden müssen, um Zuchtteiche anzulegen). Welche nachhaltige Lösung fällt Ihnen ein, um den Wert dieses Ökosystems zu maximieren?

    Lösung

    Entlang der Küstenlinie könnte man das Mangrovenökosystem intakt lassen, sodass der Küstenschutz nicht beeinträchtigt wäre. Die Teiche für die Garnelenzucht könnte man weiter im Binnenland hinter diesen Mangrovepuffern anlegen, wo sich der Verlust des Waldes nicht nennenswert auf die Schutzfunktion bei extremen Unwettern und Tsunamis auswirken würde.
  • Erklären Sie, was der Verlust biologischer Vielfalt alles umfasst, und geben Sie vier Ursachen für diese Verluste an.

    Lösung

    Der Verlust von Biodiversität umfasst Verluste auf vielen Ebenen: auf genetischer, Populations-, Art-, Ökosystem- und globaler Ebene. Die bedeutendsten Ursachen für den Verlust an biologischer Vielfalt sind die Zerstörung und Degradation von Habitaten (d.h. eine Verringerung bzw. qualitative Verschlechterung des verfügbaren Lebensraums), die Übernutzung von Arten, die Einführung gebietsfremder Arten, die sich invasiv ausbreiten, neu auftauchende Krankheiten und der Klimawandel.
  • Beschreiben Sie, wie es zum Aussterben des Heidehuhns im Jahr 1932 kam; orientieren Sie sich dabei am Konzept des Aussterbestrudels.

    Lösung

    Die Populationen des Heidehuhns wurden durch Bejagung stark dezimiert, bis schließlich 1830 nur noch eine einzige sehr kleine Population auf der Insel Martha's Vineyard in Massachusetts übrig war. Im Jahr 1908 lebten nur noch 50 Vögel. Nach Einrichtung eines speziellen Schutzgebiets erholte sich die Population zwar wieder auf mehrere Tausend Individuen, aber durch Einflüsse des Menschen und natürliche Ereignisse ging sie wieder jäh zurück. Aufgrund der geringen Populationsgröße kam es zu Inzuchtdepression und demographischer Stochastizität, wodurch sich die effektive Populationsgröße noch weiter verringerte, bis 1928 letztlich nur noch zwei Weibchen und elf Männchen verblieben waren – und somit nicht genügend Individuen oder genetische Variabilität, um das Aussterben des Heidehuhns zu verhindern.
  • Warum gestaltet es sich so schwierig zu ermitteln, wie viele Arten ausgestorben oder vom Aussterben bedroht sind?

    Lösung

    Zu ermitteln, wie viele Arten ausgestorben oder vom Aussterben bedroht sind, erweist sich aus vielen verschiedenen Gründen als schwierig. Erstens wissen wir gar nicht, wie viele Arten heute tatsächlich auf der Erde leben, weil viele davon noch gar nicht beschrieben wurden. Manche Arten sind wahrscheinlich bereits ausgestorben, bevor sie überhaupt beschrieben werden konnten. Zweitens sind viele der schon beschriebenen Spezies sehr klein und leben so zurückgezogen, dass es schwierig ist, sie überhaupt nachzuweisen. Drittens bereitet es Schwierigkeiten, mit Sicherheit sagen zu können, ob eine Art tatsächlich ausgestorben ist; das gilt insbesondere für seltene Spezies. Viertens gibt es unter den Forschern für viele taxonomische Gruppe nur sehr wenige Spezialisten. Es gibt durchaus Fälle, in denen Arten als ausgestorben galten, zu einem späteren Zeitpunkt aber wiederentdeckt wurden. Fünftens kennen wir kaum einmal alle Wechselbeziehungen zwischen Arten. Ob das Verschwinden einer Art zum Verlust weiterer Spezies führen wird, ist schwer zu prognostizieren, sofern nicht detaillierte ökologische Erkenntnisse über sämtliche betreffenden Arten vorliegen.
  • Inwiefern trägt die Fragmentierung von Habitaten zum Aussterben von Arten bei?

    Lösung

    Je stärker fragmentiert ein Habitat ist, desto kleiner und stärker isoliert sind auch die Fragmente, sodass sich Randeffekte stärker bemerkbar machen. Durch die Fragmentierung verringert sich die Populationsgröße von Arten und die Populationen werden zunehmend voneinander isoliert – mit der Folge, dass sich die Individuen nicht mehr so gut in der Metapopulation verbreiten können. Kleine und isolierte Populationen sind besonders anfällig dafür, in einen Aussterbestrudel zu geraten.
  • Erörtern Sie, wie das Verschwinden der Wölfe aus dem Yellowstone-Nationalpark wahrscheinlich zu einem Rückgang der Hartholzbäume geführt hat.

    Lösung

    Wie William Ripple und seine Mitarbeiter mit ihren Forschungen im Yellowstone-Nationalpark zeigen konnten, haben die Wölfe eine trophische Kaskade ausgelöst, von der Hartholzbäume wie Espen (Zitterpappeln) profitierten. Weil die Wölfe die Wapitihirsche dezimierten, verringerten sie den Fraßdruck durch diese Herbivoren auf die Espensämlinge, sodass Espenwälder aus adulten Bäumen entstehen konnten. Nach der Ausrottung der Wölfe im Nationalpark durch Bejagung im Jahr 1926 ging die Zahl der Espen wegen der starken Beweidung durch Wapitihirsche nach und nach zurück.
  • Geben Sie drei Gründe dafür an, warum sich invasive Arten negativ auf die Biodiversität und auf Ökosysteme auswirken können.

    Lösung

    Invasive Arten können sich beispielsweise aus folgenden drei Gründen negativ auf die Biodiversität und Ökosysteme auswirken: Erstens können sie heimische Arten durch Prädation, Konkurrenz und die Übertragung von Krankheiten im Bestand bedrohen, zweitens können sie Ökosystemfunktionen und -leistungen verändern, etwa, indem sie Feuerzyklen, die Verfügbarkeit von Wasser oder die Sedimentbildung beeinflussen, und drittens können sie sich auf die genetische Vielfalt der heimischen Arten auswirken, wenn sie mit diesen hybridisieren.
  • Angenommen, Ihnen lägen für eine Schmetterlingsart ökologische Daten aus den letzten 50 Jahren vor. Nach diesen Daten hat sich das Areal dieser Art um 100 km nach Norden verschoben, und die Verwandlung zum adulten Schmetterling erfolgt vier Tage früher als noch vor 50 Jahren. Lassen diese Daten darauf schließen, dass die Schmetterlingsart auf die Klimaerwärmung reagiert? Erläutern Sie Ihre Antwort.

    Lösung

    Ja, diese Daten deuten sehr stark auf die Klimaerwärmung als Ursache dafür hin, dass sich das Areal der Schmetterlingsart in kühlere Gebiete mit optimaleren Temperaturbedingungen weiter im Norden verschoben hat. Außerdem erfolgt die Verwandlung zum Schmetterling früher, wenn optimale Temperaturen für dieses Ereignis des Lebenszyklus herrschen.
  • Entwerfen Sie einen Plan für das bestmögliche, aber gleichzeitig realistische Schutzgebiet, um die terrestrische Biodiversität in der Gegenwart und Zukunft zu bewahren. Greifen Sie dabei auf die Grundprinzipien zur Einrichtung von Schutzgebieten zurück sowie auf die Erkenntnisse darüber, wie sich die globale Erwärmung auf die Verbreitung von Arten auswirken kann.

    Lösung

    Bei der Planung von Schutzgebieten sind drei grundlegende Prinzipien zu berücksichtigen: Erstens muss man eine ausreichend großes, relativ ungestörtes Gebiet ausfindig machen, das als Kernzone für das Reservat dienen kann. Zweitens muss um diese Kernzone herum eine Pufferzone eingerichtet werden, in der einige für die betreffende Art wichtige Faktoren gegeben sind, in der aber eine Nutzung durch den Menschen nicht so streng unterbunden wird. Drittens müssen Habitate miteinander verbunden sein (Konnektivität), damit Populationen nicht von der übergeordneten Metapopulation isoliert werden und dadurch dem Aussterben geweiht sind. Unter Berücksichtigung der globalen Klimaerwärmung in terrestrischen Systemen sollte es neben dem neuen Schutzgebiet weiter nördlich (oder auf der Südhalbkugel weiter südlich) noch ähnliche, am besten durch Korridore angebundene weitere Schutzgebiete geben, die bei einem Temperaturanstieg als Rückzugsgebiete dienen können. Ein Beispiel hierfür ist die im Kapitel vorgestellte Schutzinitiative Yellowstone to Yukon.
  • Beschreiben Sie am Beispiel des Kalifornischen Kondors, inwiefern es für eine erfolgreiche Bestandserholung von Arten von grundsätzlicher Bedeutung ist, ökologische Informationen, sozioökonomische Interessen und behördliche Instanzen zu berücksichtigen.

    Lösung

    Für den Rückgang des Kalifornischen Kondors in seinem natürlichen Verbreitungsgebiet (von British Columbia in Kanada bis nach Mexiko) waren mehrere Faktoren verantwortlich: Bleivergiftungen durch die Aufnahme von bleihaltiger Munition in Kadavern, Unfälle an Hochspannungsleitungen, dünnere Eischalen aufgrund des Einsatzes von Pestiziden sowie die Bejagung (ökologische Informationen). Um den Kalifornischen Kondor vor dem Aussterben zu bewahren, wurde das Gesetz Endangered Species Act verabschiedet (öffentliche Instanzen) und 1983 die letzten Tiere in der Natur lebenden Individuen für ein Zuchtprogramm in Menschenobhut eingefangen. Das Zuchtprogramm erwies sich als erfolgreich, aber ökologische Informationen deuteten darauf hin, dass eine Wiederansiedlung der Vögel in der Natur erst dann sinnvoll sein würde, wenn es gelänge, die Ursachen für den Rückgang abzumildern. Im Jahr 2008 wurde ein Gesetz erlassen (Ridley-Tree Condor Preservation Act), demzufolge Jäger in Kalifornien bei der Jagd im Verbreitungsgebiet der Kondore nur noch bleifreie Munition verwenden durften. Zusätzlich wurden Jäger und Viehfarmer durch öffentliche Kampagnen aufgeklärt, dass die Kondore nicht, wie fälschlicherweise angenommen, Vieh töten (sozioökonomische Interessen).
  • Fertig!

    Zurück zu Frage 1
Zurück
Frage 1 von 745
Weiter

Weitere Videos zum Thema

Purves Biologie



Dozentenmaterialien

Hier finden Sie die zum Buch gehörenden Dozentenmaterialien.
Registrieren Sie sich, oder melden Sie sich an, falls Sie bereits registriert sind.

News